Incidental Mutation 'R5053:As3mt'
ID394783
Institutional Source Beutler Lab
Gene Symbol As3mt
Ensembl Gene ENSMUSG00000003559
Gene Namearsenic (+3 oxidation state) methyltransferase
Synonyms2310045H08Rik, Cyt19
MMRRC Submission 042643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5053 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location46707443-46741095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46709054 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 87 (Y87C)
Ref Sequence ENSEMBL: ENSMUSP00000003655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003655]
Predicted Effect probably damaging
Transcript: ENSMUST00000003655
AA Change: Y87C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003655
Gene: ENSMUSG00000003559
AA Change: Y87C

DomainStartEndE-ValueType
Pfam:Methyltransf_23 34 227 2.5e-14 PFAM
Pfam:PCMT 64 183 7.7e-9 PFAM
Pfam:Ubie_methyltran 64 196 8.9e-16 PFAM
Pfam:PrmA 65 193 1.8e-6 PFAM
Pfam:Methyltransf_31 70 243 2e-36 PFAM
Pfam:Methyltransf_18 71 187 9.7e-14 PFAM
Pfam:Methyltransf_25 75 180 2.8e-15 PFAM
Pfam:Methyltransf_12 76 182 2.9e-14 PFAM
Pfam:Methyltransf_11 76 184 2.7e-19 PFAM
low complexity region 297 310 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AS3MT catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (AdoMet) to trivalent arsenical and may play a role in arsenic metabolism (Lin et al., 2002 [PubMed 11790780]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormalities in arsenic methylation and in the distribution/retention of orally administered arsenate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Alg9 G T 9: 50,788,172 G200W probably damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Erg T A 16: 95,524,534 H11L probably benign Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Lmnb2 A T 10: 80,904,655 M223K probably damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Ndc1 T C 4: 107,374,218 S119P probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1211 C A 2: 88,930,253 V21F probably benign Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Sec31a G T 5: 100,393,214 Q345K possibly damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Sp8 C T 12: 118,849,604 T398M probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Trim3 G T 7: 105,617,761 D470E probably damaging Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zfp819 C T 7: 43,617,146 T275I probably damaging Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in As3mt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:As3mt APN 19 46720425 missense probably benign 0.06
IGL00903:As3mt APN 19 46712234 missense probably benign 0.04
IGL02190:As3mt APN 19 46719945 missense probably benign 0.38
IGL03088:As3mt APN 19 46707794 missense probably damaging 1.00
PIT4791001:As3mt UTSW 19 46720349 missense probably damaging 1.00
R1797:As3mt UTSW 19 46724934 missense possibly damaging 0.92
R2157:As3mt UTSW 19 46707792 missense probably benign 0.36
R3113:As3mt UTSW 19 46715278 splice site probably benign
R3816:As3mt UTSW 19 46707777 missense probably benign 0.32
R4819:As3mt UTSW 19 46707529 unclassified probably benign
R5333:As3mt UTSW 19 46708196 missense probably null 0.97
R6003:As3mt UTSW 19 46708128 missense possibly damaging 0.85
R6269:As3mt UTSW 19 46719952 missense probably damaging 1.00
R6281:As3mt UTSW 19 46724923 missense possibly damaging 0.56
R6317:As3mt UTSW 19 46724971 missense probably benign 0.01
R6803:As3mt UTSW 19 46709581 missense probably benign 0.01
R7346:As3mt UTSW 19 46720452 missense probably damaging 1.00
R8061:As3mt UTSW 19 46740543 missense probably damaging 1.00
R8331:As3mt UTSW 19 46709006 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTACAATGCTGCTAGGG -3'
(R):5'- GTGCCACTGTTGTCACAAGC -3'

Sequencing Primer
(F):5'- AGACGTGGCCCTGTTGAG -3'
(R):5'- TGTCACAAGCTCATCTACCAGGTTAG -3'
Posted On2016-06-15