Incidental Mutation 'R5127:Arhgef5'
ID 394816
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor (GEF) 5
Synonyms 2210412D05Rik
MMRRC Submission 042715-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5127 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 43265582-43289320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43273214 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 300 (N300Y)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: N300Y

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: N300Y

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Meta Mutation Damage Score 0.1067 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,992 K497E probably damaging Het
4933413J09Rik A G 14: 26,376,307 noncoding transcript Het
Aox1 A T 1: 58,030,026 I4F probably benign Het
B530045E10Rik A G 10: 99,422,121 noncoding transcript Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdh20 A G 1: 104,947,348 E285G probably damaging Het
Cfap54 A T 10: 92,886,387 probably null Het
Col6a3 A G 1: 90,768,345 C2667R unknown Het
Cts8 C T 13: 61,253,335 V126M probably damaging Het
Dag1 A T 9: 108,207,572 I790N possibly damaging Het
Ddit4 A G 10: 59,950,669 I186T probably damaging Het
Dnajc11 T A 4: 151,969,814 probably benign Het
Farsa A G 8: 84,868,964 D495G probably benign Het
Gm10125 T C 18: 5,567,390 noncoding transcript Het
Gm1527 T A 3: 28,903,418 I157N probably damaging Het
Gm5773 T A 3: 93,773,428 W136R probably benign Het
Hpse C A 5: 100,719,537 A20S unknown Het
Igfn1 A G 1: 135,959,896 Y2477H probably damaging Het
Kcnh5 A G 12: 74,898,084 V797A probably benign Het
Kptn T A 7: 16,125,785 C311* probably null Het
Lpcat2 A T 8: 92,909,191 N407I possibly damaging Het
Lrp1 T A 10: 127,539,634 probably benign Het
Ovol2 C T 2: 144,317,860 C120Y probably damaging Het
Pcdhac2 G T 18: 37,144,299 E111* probably null Het
Pknox1 C T 17: 31,590,739 P106S probably benign Het
Plet1 C T 9: 50,504,295 T155I probably benign Het
Ppfia2 A G 10: 106,835,760 K444R probably damaging Het
Prrc2c A T 1: 162,697,846 I397N unknown Het
Ranbp1 A G 16: 18,247,287 probably null Het
Raver2 T C 4: 101,102,985 C221R probably damaging Het
Reps1 A G 10: 18,093,880 T244A probably benign Het
Slc22a16 G A 10: 40,573,957 V130I probably benign Het
Stmnd1 G A 13: 46,299,595 S249N probably benign Het
Styx A G 14: 45,373,504 probably null Het
Sult1b1 T G 5: 87,521,548 N147T probably damaging Het
Tbc1d2 G A 4: 46,633,639 probably benign Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Ufl1 T C 4: 25,256,010 E423G probably benign Het
Unc13c T C 9: 73,933,372 I66V probably benign Het
Wfdc10 C T 2: 164,657,140 Q57* probably null Het
Zfp369 A T 13: 65,279,033 probably benign Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43280645 missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43287624 missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43284006 missense
R9610:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43274802 missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43273593 missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACTCTGAACGAAGGCATTTG -3'
(R):5'- GTCACCTGAGTCTACAACCTCC -3'

Sequencing Primer
(F):5'- ACTCTGAACGAAGGCATTTGTTTTG -3'
(R):5'- GAGTCTACAACCTCCTTCTGG -3'
Posted On 2016-06-21