Incidental Mutation 'R5128:Mroh9'
ID394845
Institutional Source Beutler Lab
Gene Symbol Mroh9
Ensembl Gene ENSMUSG00000071890
Gene Namemaestro heat-like repeat family member 9
Synonyms4921528O07Rik, Armc11
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163024302-163085670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 163060760 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 249 (G249R)
Ref Sequence ENSEMBL: ENSMUSP00000094365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096608]
Predicted Effect probably damaging
Transcript: ENSMUST00000096608
AA Change: G249R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094365
Gene: ENSMUSG00000071890
AA Change: G249R

DomainStartEndE-ValueType
SCOP:d1gw5b_ 231 716 2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195132
Meta Mutation Damage Score 0.1745 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Mroh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Mroh9 APN 1 163045781 missense possibly damaging 0.89
IGL00705:Mroh9 APN 1 163079503 missense probably damaging 1.00
IGL00788:Mroh9 APN 1 163024658 missense probably benign 0.06
IGL00795:Mroh9 APN 1 163060622 missense probably damaging 1.00
IGL00815:Mroh9 APN 1 163039131 missense probably damaging 1.00
IGL01025:Mroh9 APN 1 163047866 missense possibly damaging 0.67
IGL01303:Mroh9 APN 1 163080575 missense probably benign 0.00
IGL01526:Mroh9 APN 1 163055603 missense probably damaging 0.99
IGL01680:Mroh9 APN 1 163047982 splice site probably null
IGL01823:Mroh9 APN 1 163055609 missense probably benign 0.39
IGL02024:Mroh9 APN 1 163062502 missense possibly damaging 0.65
IGL02213:Mroh9 APN 1 163058079 missense probably damaging 1.00
IGL02455:Mroh9 APN 1 163075580 missense probably benign 0.03
IGL02546:Mroh9 APN 1 163080576 missense probably benign 0.04
IGL03059:Mroh9 APN 1 163024636 missense possibly damaging 0.95
IGL03061:Mroh9 APN 1 163026502 missense probably damaging 1.00
IGL03071:Mroh9 APN 1 163039197 missense probably damaging 1.00
R0048:Mroh9 UTSW 1 163062487 missense probably damaging 0.97
R0048:Mroh9 UTSW 1 163062487 missense probably damaging 0.97
R0441:Mroh9 UTSW 1 163060762 missense probably damaging 1.00
R0506:Mroh9 UTSW 1 163060636 missense possibly damaging 0.90
R0629:Mroh9 UTSW 1 163060636 missense possibly damaging 0.90
R0751:Mroh9 UTSW 1 163066124 missense possibly damaging 0.84
R1301:Mroh9 UTSW 1 163043983 critical splice donor site probably null
R1481:Mroh9 UTSW 1 163026509 missense probably damaging 1.00
R1618:Mroh9 UTSW 1 163024541 missense probably benign 0.00
R1647:Mroh9 UTSW 1 163046056 missense probably damaging 1.00
R1648:Mroh9 UTSW 1 163046056 missense probably damaging 1.00
R1668:Mroh9 UTSW 1 163024592 missense possibly damaging 0.52
R1795:Mroh9 UTSW 1 163056778 missense probably damaging 0.97
R1796:Mroh9 UTSW 1 163045710 missense probably damaging 1.00
R1857:Mroh9 UTSW 1 163039145 missense probably damaging 0.98
R1869:Mroh9 UTSW 1 163026513 missense probably damaging 0.97
R1923:Mroh9 UTSW 1 163076291 missense probably damaging 1.00
R2325:Mroh9 UTSW 1 163026530 splice site probably null
R2511:Mroh9 UTSW 1 163038945 missense probably benign 0.13
R2912:Mroh9 UTSW 1 163044003 missense probably damaging 1.00
R2913:Mroh9 UTSW 1 163044003 missense probably damaging 1.00
R2919:Mroh9 UTSW 1 163056772 missense probably damaging 1.00
R2973:Mroh9 UTSW 1 163056769 missense probably damaging 1.00
R3912:Mroh9 UTSW 1 163066069 missense probably damaging 0.97
R4034:Mroh9 UTSW 1 163080553 critical splice donor site probably null
R4551:Mroh9 UTSW 1 163044093 missense probably damaging 0.98
R4656:Mroh9 UTSW 1 163066024 missense probably damaging 1.00
R4662:Mroh9 UTSW 1 163055593 missense probably damaging 0.97
R4743:Mroh9 UTSW 1 163024492 missense probably benign 0.05
R4890:Mroh9 UTSW 1 163026524 missense probably damaging 1.00
R5129:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5147:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5157:Mroh9 UTSW 1 163044121 missense probably damaging 0.96
R5324:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5325:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5340:Mroh9 UTSW 1 163080587 start gained probably benign
R6005:Mroh9 UTSW 1 163075677 missense probably damaging 0.99
R6182:Mroh9 UTSW 1 163066043 nonsense probably null
R6414:Mroh9 UTSW 1 163074702 missense probably damaging 1.00
R6477:Mroh9 UTSW 1 163076304 missense probably damaging 1.00
R6540:Mroh9 UTSW 1 163038972 missense possibly damaging 0.87
R6541:Mroh9 UTSW 1 163058038 missense possibly damaging 0.78
R6643:Mroh9 UTSW 1 163075561 missense probably damaging 1.00
R6811:Mroh9 UTSW 1 163046041 missense possibly damaging 0.86
R6830:Mroh9 UTSW 1 163076366 missense probably benign
R7026:Mroh9 UTSW 1 163060682 missense probably benign 0.00
R7052:Mroh9 UTSW 1 163038956 missense possibly damaging 0.92
R7068:Mroh9 UTSW 1 163039181 missense probably damaging 1.00
R7350:Mroh9 UTSW 1 163076289 critical splice donor site probably null
R7545:Mroh9 UTSW 1 163074708 missense possibly damaging 0.56
R7615:Mroh9 UTSW 1 163046032 missense probably benign 0.40
R7743:Mroh9 UTSW 1 163024553 missense probably benign
R7808:Mroh9 UTSW 1 163039109 missense probably damaging 1.00
R8024:Mroh9 UTSW 1 163039233 missense not run
R8062:Mroh9 UTSW 1 163038975 missense not run
RF003:Mroh9 UTSW 1 163058061 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTTTTGAGAGCACGCTC -3'
(R):5'- TGCCTAATAGTACCTGGAACTTC -3'

Sequencing Primer
(F):5'- GAGCACGCTCTGTTCTTCTTAG -3'
(R):5'- GGAACTTCCATCATCATTGCAC -3'
Posted On2016-06-21