Incidental Mutation 'R5128:Ttc16'
ID394846
Institutional Source Beutler Lab
Gene Symbol Ttc16
Ensembl Gene ENSMUSG00000039021
Gene Nametetratricopeptide repeat domain 16
Synonyms1200002K10Rik
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32757026-32775633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32762997 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 550 (I550F)
Ref Sequence ENSEMBL: ENSMUSP00000123927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009707] [ENSMUST00000066478] [ENSMUST00000091059] [ENSMUST00000125891] [ENSMUST00000156617] [ENSMUST00000161089] [ENSMUST00000161430] [ENSMUST00000161950] [ENSMUST00000175763] [ENSMUST00000177382]
Predicted Effect probably benign
Transcript: ENSMUST00000009707
SMART Domains Protein: ENSMUSP00000009707
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Torsin 35 160 1.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066478
AA Change: I550F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000068977
Gene: ENSMUSG00000039021
AA Change: I550F

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091059
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125891
Predicted Effect probably benign
Transcript: ENSMUST00000140999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149987
Predicted Effect probably benign
Transcript: ENSMUST00000156617
SMART Domains Protein: ENSMUSP00000122251
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161089
AA Change: I550F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124915
Gene: ENSMUSG00000039021
AA Change: I550F

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161430
AA Change: I607F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124031
Gene: ENSMUSG00000039021
AA Change: I607F

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 596 611 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
low complexity region 686 697 N/A INTRINSIC
low complexity region 782 807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161950
AA Change: I550F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123927
Gene: ENSMUSG00000039021
AA Change: I550F

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175763
SMART Domains Protein: ENSMUSP00000135701
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177382
SMART Domains Protein: ENSMUSP00000134968
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Torsin 35 101 1.4e-25 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Ttc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ttc16 APN 2 32770247 missense probably damaging 1.00
IGL02931:Ttc16 APN 2 32771927 missense probably damaging 1.00
IGL03143:Ttc16 APN 2 32774445 missense possibly damaging 0.86
IGL03206:Ttc16 APN 2 32771885 unclassified probably null
IGL03310:Ttc16 APN 2 32762397 unclassified probably benign
P0033:Ttc16 UTSW 2 32762574 missense probably benign 0.00
R0909:Ttc16 UTSW 2 32762868 missense probably benign 0.08
R1085:Ttc16 UTSW 2 32775080 missense possibly damaging 0.83
R1659:Ttc16 UTSW 2 32762535 missense probably benign 0.15
R1752:Ttc16 UTSW 2 32772150 missense probably damaging 0.96
R2408:Ttc16 UTSW 2 32768008 missense probably benign 0.00
R3835:Ttc16 UTSW 2 32769310 missense probably damaging 0.99
R4576:Ttc16 UTSW 2 32770059 missense probably benign 0.02
R4590:Ttc16 UTSW 2 32773741 missense probably damaging 1.00
R4630:Ttc16 UTSW 2 32775377 start gained probably benign
R5081:Ttc16 UTSW 2 32767976 missense probably damaging 1.00
R5642:Ttc16 UTSW 2 32775336 missense probably damaging 0.99
R5704:Ttc16 UTSW 2 32769125 missense probably damaging 1.00
R6384:Ttc16 UTSW 2 32767549 missense probably damaging 1.00
R6723:Ttc16 UTSW 2 32768037 missense possibly damaging 0.66
R7103:Ttc16 UTSW 2 32774428 missense probably benign 0.00
R7295:Ttc16 UTSW 2 32774425 missense probably null 0.02
R7570:Ttc16 UTSW 2 32768968 missense probably damaging 1.00
Z1088:Ttc16 UTSW 2 32769333 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGAGTCCCTTTGGCCATAG -3'
(R):5'- CTCAGTACTGTTTGAGCAGCG -3'

Sequencing Primer
(F):5'- ACCTCAGTGGCGTTCTGGATTAG -3'
(R):5'- TGAGCAGCGTCTTGTCAC -3'
Posted On2016-06-21