Incidental Mutation 'R5128:4930430A15Rik'
ID394849
Institutional Source Beutler Lab
Gene Symbol 4930430A15Rik
Ensembl Gene ENSMUSG00000027157
Gene NameRIKEN cDNA 4930430A15 gene
Synonyms
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111162061-111229602 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 111164329 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 251 (Q251*)
Ref Sequence ENSEMBL: ENSMUSP00000117759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000142636]
Predicted Effect probably null
Transcript: ENSMUST00000142636
AA Change: Q251*
SMART Domains Protein: ENSMUSP00000117759
Gene: ENSMUSG00000027157
AA Change: Q251*

DomainStartEndE-ValueType
internal_repeat_1 1 69 7.48e-6 PROSPERO
internal_repeat_1 81 153 7.48e-6 PROSPERO
low complexity region 168 183 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in 4930430A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:4930430A15Rik APN 2 111220762 missense probably damaging 0.98
IGL01403:4930430A15Rik APN 2 111229170 unclassified probably benign
IGL01431:4930430A15Rik APN 2 111225395 unclassified probably benign
IGL01601:4930430A15Rik APN 2 111193478 missense unknown
IGL01649:4930430A15Rik APN 2 111214576 splice site probably benign
IGL02355:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02362:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02485:4930430A15Rik APN 2 111228325 missense probably damaging 0.97
IGL02620:4930430A15Rik APN 2 111211625 missense probably benign 0.00
IGL03156:4930430A15Rik APN 2 111200412 missense possibly damaging 0.90
IGL02980:4930430A15Rik UTSW 2 111164473 missense unknown
R0577:4930430A15Rik UTSW 2 111194349 missense probably benign 0.27
R0638:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R0645:4930430A15Rik UTSW 2 111214583 critical splice donor site probably null
R0671:4930430A15Rik UTSW 2 111204137 missense possibly damaging 0.93
R0829:4930430A15Rik UTSW 2 111198105 missense possibly damaging 0.92
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1486:4930430A15Rik UTSW 2 111200358 missense possibly damaging 0.84
R1509:4930430A15Rik UTSW 2 111218627 missense probably benign
R1672:4930430A15Rik UTSW 2 111220774 missense probably benign 0.00
R2073:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2074:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2075:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2899:4930430A15Rik UTSW 2 111220670 splice site probably benign
R2965:4930430A15Rik UTSW 2 111204019 missense possibly damaging 0.61
R3110:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R3112:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R4489:4930430A15Rik UTSW 2 111220702 missense probably benign 0.31
R4821:4930430A15Rik UTSW 2 111204145 critical splice acceptor site probably null
R4925:4930430A15Rik UTSW 2 111218616 missense probably benign 0.41
R5045:4930430A15Rik UTSW 2 111193459 missense unknown
R5057:4930430A15Rik UTSW 2 111225421 missense probably benign 0.12
R5250:4930430A15Rik UTSW 2 111228077 missense possibly damaging 0.87
R5333:4930430A15Rik UTSW 2 111194337 missense possibly damaging 0.92
R5376:4930430A15Rik UTSW 2 111215599 missense probably benign 0.44
R5677:4930430A15Rik UTSW 2 111211565 missense probably benign
R5722:4930430A15Rik UTSW 2 111204123 missense probably benign
R5735:4930430A15Rik UTSW 2 111225492 nonsense probably null
R6170:4930430A15Rik UTSW 2 111227948 missense probably benign 0.03
R6366:4930430A15Rik UTSW 2 111169592 critical splice donor site probably null
R6496:4930430A15Rik UTSW 2 111164472 missense unknown
R6654:4930430A15Rik UTSW 2 111171884 missense unknown
R6983:4930430A15Rik UTSW 2 111228250 critical splice donor site probably null
R7371:4930430A15Rik UTSW 2 111193481 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGGTATGTGACTTAGACTTCAC -3'
(R):5'- TGCTATTCCCAAACCTAAACATGAG -3'

Sequencing Primer
(F):5'- CTTCACAACTTTAAACACATTATCCC -3'
(R):5'- CTTTGATATTTTAGACTCTCCTGAGG -3'
Posted On2016-06-21