Mutagenetix > Incidental Mutations

Incidental Mutation 'R5128:Mertk'

394851

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

042716-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R5128 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 128738247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 207 (T207K)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably damaging
Transcript: ENSMUST00000014505
AA Change: T207K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: T207K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Meta Mutation Damage Score

0.1217

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	G	A	2: 111,164,329	Q251*	probably null	Het
Abcc6	A	G	7: 45,989,646	S958P	probably benign	Het
Ahnak	T	C	19: 9,017,087	L5245P	probably damaging	Het
Alg5	T	A	3: 54,742,137		probably null	Het
Anapc1	A	G	2: 128,659,917	V735A	probably benign	Het
Arhgap45	A	G	10: 80,030,959	T1099A	probably benign	Het
Cacna1e	A	C	1: 154,402,021	S2062A	probably damaging	Het
Chrna9	A	G	5: 65,971,222	S258G	probably benign	Het
Ctcfl	T	C	2: 173,117,396	E179G	probably benign	Het
Dcdc2a	C	A	13: 25,102,529	A145E	probably damaging	Het
Dgkz	A	G	2: 91,942,683	I343T	probably damaging	Het
Dnah1	T	C	14: 31,296,195		probably null	Het
Dqx1	T	C	6: 83,060,567	L374P	probably damaging	Het
Entpd5	A	T	12: 84,394,690	F101L	probably benign	Het
Esco1	A	T	18: 10,567,468		probably benign	Het
Fgf1	C	A	18: 38,842,025	V124L	probably benign	Het
Gm16380	C	T	9: 53,884,113		noncoding transcript	Het
Grid2	G	A	6: 64,665,998	A915T	probably benign	Het
Inhbc	A	T	10: 127,357,742	M135K	probably benign	Het
Mroh9	C	G	1: 163,060,760	G249R	probably damaging	Het
Mtmr10	C	T	7: 64,333,439	T498I	probably damaging	Het
Muc3	A	G	5: 137,138,186		probably null	Het
Nlrp1c-ps	G	T	11: 71,279,595		noncoding transcript	Het
Nphp4	T	A	4: 152,502,991	I267N	probably benign	Het
Obox8	A	G	7: 14,332,090	W168R	probably damaging	Het
Olfr1247	A	T	2: 89,609,303	D266E	probably damaging	Het
Olfr143	T	C	9: 38,253,570	L48P	probably damaging	Het
Olfr330	A	T	11: 58,529,422	V188E	probably damaging	Het
Pafah1b1	A	G	11: 74,679,436		probably benign	Het
Palld	T	C	8: 61,720,588	T346A	probably damaging	Het
Pip4k2b	A	G	11: 97,718,876	S412P	probably benign	Het
Scn3a	T	C	2: 65,508,518	S606G	probably benign	Het
Slc12a7	G	T	13: 73,805,433	S754I	probably benign	Het
Tep1	A	G	14: 50,844,279	*489R	probably null	Het
Tnn	A	T	1: 160,122,894	V714E	probably damaging	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Ttc16	T	A	2: 32,762,997	I550F	probably benign	Het
Vit	T	C	17: 78,625,146	S561P	probably damaging	Het
Zdhhc1	T	A	8: 105,483,636	I50F	probably benign	Het
Zfp451	C	T	1: 33,802,933		probably benign	Het
Zfp597	G	A	16: 3,872,124		probably benign	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCTAGAAAGCTGGCTGG -3'
(R):5'- TTGTCACCTTTACAGTTAGAGGGG -3'

Sequencing Primer
(F):5'- GACTGGGAGTCAGAAACCTC -3'
(R):5'- CCTTTACAGTTAGAGGGGAAGAAAC -3'

Posted On

2016-06-21