Mutagenetix > Incidental Mutations

Incidental Mutation 'R5128:Ctcfl'

394852

Institutional Source

Beutler Lab

Gene Symbol

Ctcfl

Ensembl Gene

ENSMUSG00000070495

Gene Name

CCCTC-binding factor (zinc finger protein)-like

Synonyms

Boris, OTTMUSG00000016680

MMRRC Submission

042716-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.314) question?

Stock #

R5128 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

173093609-173119525 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 173117396 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 179 (E179G)

Ref Sequence

ENSEMBL: ENSMUSP00000135932 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094287] [ENSMUST00000179693]

Predicted Effect

probably benign
Transcript: ENSMUST00000094287
AA Change: E179G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000091845
Gene: ENSMUSG00000070495
AA Change: E179G

Domain	Start	End	E-Value	Type
low complexity region	194	202	N/A	INTRINSIC
ZnF_C2H2	257	279	1.79e-2	SMART
ZnF_C2H2	285	307	1.07e0	SMART
ZnF_C2H2	313	336	4.47e-3	SMART
ZnF_C2H2	342	364	1.79e-2	SMART
ZnF_C2H2	370	392	5.81e-2	SMART
ZnF_C2H2	398	421	1.36e-2	SMART
ZnF_C2H2	428	451	6.23e-2	SMART
ZnF_C2H2	458	480	1.89e-1	SMART
ZnF_C2H2	486	508	8.94e-3	SMART
ZnF_C2H2	514	537	2.32e-1	SMART
ZnF_C2H2	546	572	5.2e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142165

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144256

Predicted Effect

probably benign
Transcript: ENSMUST00000179693
AA Change: E179G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135932
Gene: ENSMUSG00000070495
AA Change: E179G

Domain	Start	End	E-Value	Type
low complexity region	194	202	N/A	INTRINSIC
ZnF_C2H2	257	279	1.79e-2	SMART
ZnF_C2H2	285	307	1.07e0	SMART
ZnF_C2H2	313	336	4.47e-3	SMART
ZnF_C2H2	342	364	1.79e-2	SMART
ZnF_C2H2	370	392	5.81e-2	SMART
ZnF_C2H2	398	421	1.36e-2	SMART
ZnF_C2H2	428	451	6.23e-2	SMART
ZnF_C2H2	458	480	1.89e-1	SMART
ZnF_C2H2	486	508	8.94e-3	SMART
ZnF_C2H2	514	537	2.32e-1	SMART
ZnF_C2H2	546	572	5.2e0	SMART

Meta Mutation Damage Score

0.0856

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small testes, delayed spermatid development, and increased male germ cell apoptosis without affecting fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	G	A	2: 111,164,329	Q251*	probably null	Het
Abcc6	A	G	7: 45,989,646	S958P	probably benign	Het
Ahnak	T	C	19: 9,017,087	L5245P	probably damaging	Het
Alg5	T	A	3: 54,742,137		probably null	Het
Anapc1	A	G	2: 128,659,917	V735A	probably benign	Het
Arhgap45	A	G	10: 80,030,959	T1099A	probably benign	Het
Cacna1e	A	C	1: 154,402,021	S2062A	probably damaging	Het
Chrna9	A	G	5: 65,971,222	S258G	probably benign	Het
Dcdc2a	C	A	13: 25,102,529	A145E	probably damaging	Het
Dgkz	A	G	2: 91,942,683	I343T	probably damaging	Het
Dnah1	T	C	14: 31,296,195		probably null	Het
Dqx1	T	C	6: 83,060,567	L374P	probably damaging	Het
Entpd5	A	T	12: 84,394,690	F101L	probably benign	Het
Esco1	A	T	18: 10,567,468		probably benign	Het
Fgf1	C	A	18: 38,842,025	V124L	probably benign	Het
Gm16380	C	T	9: 53,884,113		noncoding transcript	Het
Grid2	G	A	6: 64,665,998	A915T	probably benign	Het
Inhbc	A	T	10: 127,357,742	M135K	probably benign	Het
Mertk	C	A	2: 128,738,247	T207K	probably damaging	Het
Mroh9	C	G	1: 163,060,760	G249R	probably damaging	Het
Mtmr10	C	T	7: 64,333,439	T498I	probably damaging	Het
Muc3	A	G	5: 137,138,186		probably null	Het
Nlrp1c-ps	G	T	11: 71,279,595		noncoding transcript	Het
Nphp4	T	A	4: 152,502,991	I267N	probably benign	Het
Obox8	A	G	7: 14,332,090	W168R	probably damaging	Het
Olfr1247	A	T	2: 89,609,303	D266E	probably damaging	Het
Olfr143	T	C	9: 38,253,570	L48P	probably damaging	Het
Olfr330	A	T	11: 58,529,422	V188E	probably damaging	Het
Pafah1b1	A	G	11: 74,679,436		probably benign	Het
Palld	T	C	8: 61,720,588	T346A	probably damaging	Het
Pip4k2b	A	G	11: 97,718,876	S412P	probably benign	Het
Scn3a	T	C	2: 65,508,518	S606G	probably benign	Het
Slc12a7	G	T	13: 73,805,433	S754I	probably benign	Het
Tep1	A	G	14: 50,844,279	*489R	probably null	Het
Tnn	A	T	1: 160,122,894	V714E	probably damaging	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Ttc16	T	A	2: 32,762,997	I550F	probably benign	Het
Vit	T	C	17: 78,625,146	S561P	probably damaging	Het
Zdhhc1	T	A	8: 105,483,636	I50F	probably benign	Het
Zfp451	C	T	1: 33,802,933		probably benign	Het
Zfp597	G	A	16: 3,872,124		probably benign	Het

Other mutations in Ctcfl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01344:Ctcfl	APN	2	173094734	missense	possibly damaging	0.82
IGL01418:Ctcfl	APN	2	173118331	missense	probably benign	0.03
IGL01524:Ctcfl	APN	2	173117384	missense	probably benign	0.08
IGL02610:Ctcfl	APN	2	173106026	splice site	probably benign
IGL02961:Ctcfl	APN	2	173101919	missense	possibly damaging	0.70
R0147:Ctcfl	UTSW	2	173118547	missense	possibly damaging	0.75
R0148:Ctcfl	UTSW	2	173118547	missense	possibly damaging	0.75
R0362:Ctcfl	UTSW	2	173118443	missense	probably damaging	0.99
R1099:Ctcfl	UTSW	2	173112360	missense	probably damaging	1.00
R1540:Ctcfl	UTSW	2	173112348	missense	probably benign	0.36
R1892:Ctcfl	UTSW	2	173118685	missense	probably benign	0.24
R2036:Ctcfl	UTSW	2	173101985	missense	possibly damaging	0.95
R2060:Ctcfl	UTSW	2	173118506	missense	probably benign	0.00
R2925:Ctcfl	UTSW	2	173094696	missense	probably damaging	1.00
R4327:Ctcfl	UTSW	2	173113506	intron	probably benign
R4837:Ctcfl	UTSW	2	173113656	missense	probably benign	0.00
R4894:Ctcfl	UTSW	2	173117403	missense	probably benign	0.19
R4909:Ctcfl	UTSW	2	173095398	missense	probably benign	0.42
R5247:Ctcfl	UTSW	2	173113609	missense	probably damaging	1.00
R6263:Ctcfl	UTSW	2	173095337	missense	probably benign	0.00
R6768:Ctcfl	UTSW	2	173117291	missense	possibly damaging	0.84
R7045:Ctcfl	UTSW	2	173112374	missense	probably damaging	1.00
R7180:Ctcfl	UTSW	2	173105977	intron	probably null
R7256:Ctcfl	UTSW	2	173118475	missense	probably benign	0.01
R7268:Ctcfl	UTSW	2	173107795	missense	probably benign	0.26
R7378:Ctcfl	UTSW	2	173112258	missense	probably damaging	1.00
R7560:Ctcfl	UTSW	2	173118406	missense	probably damaging	0.96
R7657:Ctcfl	UTSW	2	173113656	missense	possibly damaging	0.71
R7733:Ctcfl	UTSW	2	173117192	missense	probably benign
Z1088:Ctcfl	UTSW	2	173118344	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATAATTGCTACCCTCCCAGGAG -3'
(R):5'- AGATGCTGAGTCACCGATGG -3'

Sequencing Primer
(F):5'- ATGGCCAGCCTACCCTTG -3'
(R):5'- GCTGAGTCACCGATGGCTTTC -3'

Posted On

2016-06-21