Incidental Mutation 'R5128:Ctcfl'
ID394852
Institutional Source Beutler Lab
Gene Symbol Ctcfl
Ensembl Gene ENSMUSG00000070495
Gene NameCCCTC-binding factor (zinc finger protein)-like
SynonymsBoris, OTTMUSG00000016680
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location173093609-173119525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173117396 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 179 (E179G)
Ref Sequence ENSEMBL: ENSMUSP00000135932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094287] [ENSMUST00000179693]
Predicted Effect probably benign
Transcript: ENSMUST00000094287
AA Change: E179G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091845
Gene: ENSMUSG00000070495
AA Change: E179G

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144256
Predicted Effect probably benign
Transcript: ENSMUST00000179693
AA Change: E179G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135932
Gene: ENSMUSG00000070495
AA Change: E179G

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small testes, delayed spermatid development, and increased male germ cell apoptosis without affecting fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Ctcfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Ctcfl APN 2 173094734 missense possibly damaging 0.82
IGL01418:Ctcfl APN 2 173118331 missense probably benign 0.03
IGL01524:Ctcfl APN 2 173117384 missense probably benign 0.08
IGL02610:Ctcfl APN 2 173106026 splice site probably benign
IGL02961:Ctcfl APN 2 173101919 missense possibly damaging 0.70
R0147:Ctcfl UTSW 2 173118547 missense possibly damaging 0.75
R0148:Ctcfl UTSW 2 173118547 missense possibly damaging 0.75
R0362:Ctcfl UTSW 2 173118443 missense probably damaging 0.99
R1099:Ctcfl UTSW 2 173112360 missense probably damaging 1.00
R1540:Ctcfl UTSW 2 173112348 missense probably benign 0.36
R1892:Ctcfl UTSW 2 173118685 missense probably benign 0.24
R2036:Ctcfl UTSW 2 173101985 missense possibly damaging 0.95
R2060:Ctcfl UTSW 2 173118506 missense probably benign 0.00
R2925:Ctcfl UTSW 2 173094696 missense probably damaging 1.00
R4327:Ctcfl UTSW 2 173113506 intron probably benign
R4837:Ctcfl UTSW 2 173113656 missense probably benign 0.00
R4894:Ctcfl UTSW 2 173117403 missense probably benign 0.19
R4909:Ctcfl UTSW 2 173095398 missense probably benign 0.42
R5247:Ctcfl UTSW 2 173113609 missense probably damaging 1.00
R6263:Ctcfl UTSW 2 173095337 missense probably benign 0.00
R6768:Ctcfl UTSW 2 173117291 missense possibly damaging 0.84
R7045:Ctcfl UTSW 2 173112374 missense probably damaging 1.00
R7180:Ctcfl UTSW 2 173105977 intron probably null
R7256:Ctcfl UTSW 2 173118475 missense probably benign 0.01
R7268:Ctcfl UTSW 2 173107795 missense probably benign 0.26
R7378:Ctcfl UTSW 2 173112258 missense probably damaging 1.00
R7560:Ctcfl UTSW 2 173118406 missense probably damaging 0.96
R7657:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
R7733:Ctcfl UTSW 2 173117192 missense probably benign
Z1088:Ctcfl UTSW 2 173118344 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAATTGCTACCCTCCCAGGAG -3'
(R):5'- AGATGCTGAGTCACCGATGG -3'

Sequencing Primer
(F):5'- ATGGCCAGCCTACCCTTG -3'
(R):5'- GCTGAGTCACCGATGGCTTTC -3'
Posted On2016-06-21