Incidental Mutation 'R5128:Alg5'
ID394853
Institutional Source Beutler Lab
Gene Symbol Alg5
Ensembl Gene ENSMUSG00000036632
Gene Nameasparagine-linked glycosylation 5 (dolichyl-phosphate beta-glucosyltransferase)
Synonyms2600005J22Rik, 1500026A19Rik
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54735539-54751318 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 54742137 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044567] [ENSMUST00000141191] [ENSMUST00000155273]
Predicted Effect probably null
Transcript: ENSMUST00000044567
SMART Domains Protein: ENSMUSP00000035879
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 63 174 2.1e-10 PFAM
Pfam:Glycos_transf_2 68 250 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141191
SMART Domains Protein: ENSMUSP00000118818
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143387
Predicted Effect probably benign
Transcript: ENSMUST00000155273
SMART Domains Protein: ENSMUSP00000119260
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
PHENOTYPE: Embryos homozygous for an ENU-induced mutation arrest unturned at E9.5 and display no left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Alg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Alg5 APN 3 54744719 splice site probably benign
R2008:Alg5 UTSW 3 54746473 missense possibly damaging 0.92
R3428:Alg5 UTSW 3 54735585 start codon destroyed probably null
R3547:Alg5 UTSW 3 54749315 missense probably benign 0.15
R4372:Alg5 UTSW 3 54738955 critical splice donor site probably null
R4764:Alg5 UTSW 3 54746473 missense possibly damaging 0.92
R5476:Alg5 UTSW 3 54746598 missense probably benign 0.01
R5638:Alg5 UTSW 3 54738833 missense probably benign 0.22
R6880:Alg5 UTSW 3 54738843 missense probably damaging 1.00
R6897:Alg5 UTSW 3 54748642 missense probably benign
R7317:Alg5 UTSW 3 54749331 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCACTAAGACTCTGGTCAC -3'
(R):5'- TATGTGGCATTGCAGGCAG -3'

Sequencing Primer
(F):5'- TGGGATCTGAATTATTGCTCACC -3'
(R):5'- CAGGCAGAAAAGGTTATTAAAATACC -3'
Posted On2016-06-21