Incidental Mutation 'R5128:Nphp4'
ID394854
Institutional Source Beutler Lab
Gene Symbol Nphp4
Ensembl Gene ENSMUSG00000039577
Gene Namenephronophthisis 4 (juvenile) homolog (human)
Synonymsnmf192, 4930564O18Rik
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152476706-152563183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152502991 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 267 (I267N)
Ref Sequence ENSEMBL: ENSMUSP00000080128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]
Predicted Effect probably benign
Transcript: ENSMUST00000056567
AA Change: I267N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: I267N

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081393
AA Change: I267N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: I267N

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146223
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Nphp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Nphp4 APN 4 152537309 splice site probably benign
IGL00963:Nphp4 APN 4 152537861 missense probably benign 0.01
IGL01571:Nphp4 APN 4 152556382 missense probably benign 0.21
IGL01707:Nphp4 APN 4 152538983 missense probably benign 0.00
IGL01837:Nphp4 APN 4 152488881 missense probably damaging 0.96
IGL02341:Nphp4 APN 4 152555469 splice site probably benign
IGL02558:Nphp4 APN 4 152555531 missense probably damaging 1.00
IGL02563:Nphp4 APN 4 152556220 missense probably benign 0.00
IGL02712:Nphp4 APN 4 152556275 missense probably damaging 1.00
IGL03023:Nphp4 APN 4 152524235 splice site probably null
R0280:Nphp4 UTSW 4 152551936 splice site probably benign
R0317:Nphp4 UTSW 4 152551931 critical splice donor site probably null
R0410:Nphp4 UTSW 4 152557046 missense probably benign
R0433:Nphp4 UTSW 4 152518172 missense probably benign 0.00
R0706:Nphp4 UTSW 4 152555617 missense probably damaging 0.98
R0785:Nphp4 UTSW 4 152562109 missense possibly damaging 0.58
R0890:Nphp4 UTSW 4 152498220 missense possibly damaging 0.93
R0930:Nphp4 UTSW 4 152538055 missense probably benign 0.01
R1202:Nphp4 UTSW 4 152488729 splice site probably null
R1203:Nphp4 UTSW 4 152488832 missense probably damaging 0.96
R1366:Nphp4 UTSW 4 152502926 missense probably damaging 0.96
R1452:Nphp4 UTSW 4 152547018 missense probably damaging 0.99
R1598:Nphp4 UTSW 4 152562090 missense probably benign 0.00
R1699:Nphp4 UTSW 4 152496664 missense probably damaging 0.99
R2007:Nphp4 UTSW 4 152554654 missense probably damaging 0.97
R2082:Nphp4 UTSW 4 152559364 missense probably benign 0.38
R2264:Nphp4 UTSW 4 152503008 splice site probably benign
R2280:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2281:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2926:Nphp4 UTSW 4 152518139 missense probably damaging 0.99
R3764:Nphp4 UTSW 4 152538017 splice site probably benign
R4084:Nphp4 UTSW 4 152488791 missense probably damaging 1.00
R4091:Nphp4 UTSW 4 152547018 missense probably damaging 0.97
R4240:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R4701:Nphp4 UTSW 4 152496659 missense probably damaging 1.00
R4778:Nphp4 UTSW 4 152556291 missense probably benign 0.44
R4783:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4784:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4974:Nphp4 UTSW 4 152537793 missense probably damaging 1.00
R5053:Nphp4 UTSW 4 152544462 splice site probably null
R5117:Nphp4 UTSW 4 152524232 splice site probably null
R5665:Nphp4 UTSW 4 152506485 missense probably benign 0.25
R5890:Nphp4 UTSW 4 152547079 missense probably benign 0.44
R6171:Nphp4 UTSW 4 152544449 missense probably damaging 0.99
R6601:Nphp4 UTSW 4 152503007 splice site probably null
R6772:Nphp4 UTSW 4 152544406 missense probably benign 0.07
R6806:Nphp4 UTSW 4 152538101 missense probably benign 0.02
R7006:Nphp4 UTSW 4 152488802 missense probably benign 0.12
R7124:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R7381:Nphp4 UTSW 4 152499003 missense possibly damaging 0.94
R7411:Nphp4 UTSW 4 152554717 missense probably benign 0.25
R7638:Nphp4 UTSW 4 152554534 missense probably benign 0.08
R7814:Nphp4 UTSW 4 152524272 missense possibly damaging 0.93
R7814:Nphp4 UTSW 4 152544403 missense probably damaging 1.00
R7841:Nphp4 UTSW 4 152496683 missense probably benign 0.01
T0970:Nphp4 UTSW 4 152556379 missense probably damaging 1.00
X0058:Nphp4 UTSW 4 152559707 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGTAGGAACATGGCCTGTG -3'
(R):5'- AACCCACTTTAGCTGGAAATCTAG -3'

Sequencing Primer
(F):5'- TAGGAACATGGCCTGTGTCCTC -3'
(R):5'- GGGAAAGAAATGCCTTCCTCAGTC -3'
Posted On2016-06-21