Mutagenetix > Incidental Mutations

Incidental Mutation 'R5128:Palld'

394862

Institutional Source

Beutler Lab

Gene Symbol

Palld

Ensembl Gene

ENSMUSG00000058056

Gene Name

palladin, cytoskeletal associated protein

Synonyms

2410003B16Rik

MMRRC Submission

042716-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5128 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61511433-61902690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61720588 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 346 (T346A)

Ref Sequence

ENSEMBL: ENSMUSP00000112442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121493] [ENSMUST00000121785]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034057
AA Change: T346A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056
AA Change: T346A

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	667	N/A	INTRINSIC
IGc2	796	865	3.1e-9	SMART
low complexity region	881	906	N/A	INTRINSIC
IGc2	930	998	4.92e-12	SMART
IGc2	1029	1098	1.61e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121493

SMART Domains

Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056

Domain	Start	End	E-Value	Type
IGc2	71	146	1.6e-11	SMART
low complexity region	250	284	N/A	INTRINSIC
low complexity region	298	326	N/A	INTRINSIC
low complexity region	376	407	N/A	INTRINSIC
low complexity region	416	451	N/A	INTRINSIC
IGc2	632	701	3.1e-9	SMART
low complexity region	717	742	N/A	INTRINSIC
IGc2	766	834	4.92e-12	SMART
IGc2	865	934	1.61e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121785
AA Change: T346A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: T346A

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	673	N/A	INTRINSIC
low complexity region	687	715	N/A	INTRINSIC
low complexity region	765	796	N/A	INTRINSIC
low complexity region	805	840	N/A	INTRINSIC
IGc2	1038	1107	3.1e-9	SMART
low complexity region	1123	1148	N/A	INTRINSIC
IGc2	1172	1240	4.92e-12	SMART
IGc2	1271	1340	1.61e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149042

Meta Mutation Damage Score

0.3209

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	G	A	2: 111,164,329	Q251*	probably null	Het
Abcc6	A	G	7: 45,989,646	S958P	probably benign	Het
Ahnak	T	C	19: 9,017,087	L5245P	probably damaging	Het
Alg5	T	A	3: 54,742,137		probably null	Het
Anapc1	A	G	2: 128,659,917	V735A	probably benign	Het
Arhgap45	A	G	10: 80,030,959	T1099A	probably benign	Het
Cacna1e	A	C	1: 154,402,021	S2062A	probably damaging	Het
Chrna9	A	G	5: 65,971,222	S258G	probably benign	Het
Ctcfl	T	C	2: 173,117,396	E179G	probably benign	Het
Dcdc2a	C	A	13: 25,102,529	A145E	probably damaging	Het
Dgkz	A	G	2: 91,942,683	I343T	probably damaging	Het
Dnah1	T	C	14: 31,296,195		probably null	Het
Dqx1	T	C	6: 83,060,567	L374P	probably damaging	Het
Entpd5	A	T	12: 84,394,690	F101L	probably benign	Het
Esco1	A	T	18: 10,567,468		probably benign	Het
Fgf1	C	A	18: 38,842,025	V124L	probably benign	Het
Gm16380	C	T	9: 53,884,113		noncoding transcript	Het
Grid2	G	A	6: 64,665,998	A915T	probably benign	Het
Inhbc	A	T	10: 127,357,742	M135K	probably benign	Het
Mertk	C	A	2: 128,738,247	T207K	probably damaging	Het
Mroh9	C	G	1: 163,060,760	G249R	probably damaging	Het
Mtmr10	C	T	7: 64,333,439	T498I	probably damaging	Het
Muc3	A	G	5: 137,138,186		probably null	Het
Nlrp1c-ps	G	T	11: 71,279,595		noncoding transcript	Het
Nphp4	T	A	4: 152,502,991	I267N	probably benign	Het
Obox8	A	G	7: 14,332,090	W168R	probably damaging	Het
Olfr1247	A	T	2: 89,609,303	D266E	probably damaging	Het
Olfr143	T	C	9: 38,253,570	L48P	probably damaging	Het
Olfr330	A	T	11: 58,529,422	V188E	probably damaging	Het
Pafah1b1	A	G	11: 74,679,436		probably benign	Het
Pip4k2b	A	G	11: 97,718,876	S412P	probably benign	Het
Scn3a	T	C	2: 65,508,518	S606G	probably benign	Het
Slc12a7	G	T	13: 73,805,433	S754I	probably benign	Het
Tep1	A	G	14: 50,844,279	*489R	probably null	Het
Tnn	A	T	1: 160,122,894	V714E	probably damaging	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Ttc16	T	A	2: 32,762,997	I550F	probably benign	Het
Vit	T	C	17: 78,625,146	S561P	probably damaging	Het
Zdhhc1	T	A	8: 105,483,636	I50F	probably benign	Het
Zfp451	C	T	1: 33,802,933		probably benign	Het
Zfp597	G	A	16: 3,872,124		probably benign	Het

Other mutations in Palld

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Palld	APN	8	61515935	missense	possibly damaging	0.77
IGL01083:Palld	APN	8	61538807	missense	probably benign	0.44
IGL01644:Palld	APN	8	61877478	missense	probably benign	0.28
IGL01672:Palld	APN	8	61877502	missense	probably benign	0.22
IGL01941:Palld	APN	8	61535700	missense	probably benign	0.44
IGL02037:Palld	APN	8	61525114	missense	probably damaging	1.00
IGL02126:Palld	APN	8	61877442	missense	possibly damaging	0.82
IGL02537:Palld	APN	8	61684934	missense	probably benign	0.05
IGL02632:Palld	APN	8	61515245	missense	probably damaging	1.00
IGL02809:Palld	APN	8	61515247	missense	probably damaging	1.00
IGL02901:Palld	APN	8	61876995	nonsense	probably null
IGL03400:Palld	APN	8	61513455	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0745:Palld	UTSW	8	61877703	missense	probably damaging	1.00
R1263:Palld	UTSW	8	61513457	frame shift	probably null
R1342:Palld	UTSW	8	61522882	critical splice donor site	probably null
R1893:Palld	UTSW	8	61516621	missense	probably damaging	1.00
R2017:Palld	UTSW	8	61684765	missense	probably damaging	0.99
R2102:Palld	UTSW	8	61533433	missense	possibly damaging	0.82
R2129:Palld	UTSW	8	61877361	missense	probably benign	0.00
R2246:Palld	UTSW	8	61877135	missense	probably benign	0.01
R3545:Palld	UTSW	8	61550078	missense	possibly damaging	0.95
R3815:Palld	UTSW	8	61549837	intron	probably benign
R3824:Palld	UTSW	8	61709033	missense	probably damaging	1.00
R4412:Palld	UTSW	8	61687372	missense	probably damaging	0.98
R4781:Palld	UTSW	8	61877028	missense	probably benign	0.01
R4836:Palld	UTSW	8	61687381	missense	probably benign	0.11
R4871:Palld	UTSW	8	61549781	intron	probably benign
R4963:Palld	UTSW	8	61703210	missense	probably damaging	1.00
R5036:Palld	UTSW	8	61550162	missense	probably damaging	1.00
R5343:Palld	UTSW	8	61549815	intron	probably benign
R5421:Palld	UTSW	8	61516550	missense	probably damaging	1.00
R5427:Palld	UTSW	8	61550072	missense	probably benign	0.01
R5561:Palld	UTSW	8	61516585	missense	probably damaging	1.00
R5651:Palld	UTSW	8	61538788	missense	probably damaging	1.00
R5679:Palld	UTSW	8	61684945	missense	possibly damaging	0.95
R5915:Palld	UTSW	8	61533352	critical splice donor site	probably null
R6153:Palld	UTSW	8	61550152	missense	probably damaging	1.00
R6276:Palld	UTSW	8	61513423	missense	probably damaging	1.00
R6323:Palld	UTSW	8	61720693	missense	probably damaging	1.00
R6659:Palld	UTSW	8	61533443	missense	probably benign	0.28
R7016:Palld	UTSW	8	61515998	missense	probably damaging	1.00
R7124:Palld	UTSW	8	61516645	missense	unknown
R7145:Palld	UTSW	8	61532017	missense	unknown
R7386:Palld	UTSW	8	61532052	missense	unknown
R7407:Palld	UTSW	8	61515941	nonsense	probably null
R7723:Palld	UTSW	8	61711458	missense	probably damaging	1.00
R8029:Palld	UTSW	8	61877312	missense	probably damaging	1.00
R8402:Palld	UTSW	8	61711406	missense	probably damaging	1.00
R8775:Palld	UTSW	8	61684972	missense	possibly damaging	0.73
R8775-TAIL:Palld	UTSW	8	61684972	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TTTCTAGGATCAGTAAGGCTTAACCC -3'
(R):5'- CTAGCCTAGTATGAGCCTTGC -3'

Sequencing Primer
(F):5'- GGCTTAACCCATGTAACAACTGTG -3'
(R):5'- AGCCTAGTATGAGCCTTGCTTAGC -3'

Posted On

2016-06-21