Incidental Mutation 'R5128:Zdhhc1'
ID394863
Institutional Source Beutler Lab
Gene Symbol Zdhhc1
Ensembl Gene ENSMUSG00000039199
Gene Namezinc finger, DHHC domain containing 1
Synonyms
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105472423-105496902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105483636 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 50 (I50F)
Ref Sequence ENSEMBL: ENSMUSP00000148381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044286] [ENSMUST00000212303]
Predicted Effect probably benign
Transcript: ENSMUST00000044286
AA Change: I50F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036471
Gene: ENSMUSG00000039199
AA Change: I50F

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:zf-DHHC 126 282 2.5e-38 PFAM
low complexity region 359 371 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212109
Predicted Effect probably benign
Transcript: ENSMUST00000212303
AA Change: I50F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212538
Meta Mutation Damage Score 0.0854 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Zdhhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Zdhhc1 APN 8 105472998 missense probably benign
hacked UTSW 8 105483744 frame shift probably null
middleman UTSW 8 105483647 missense probably damaging 1.00
R0329:Zdhhc1 UTSW 8 105483543 missense probably benign 0.04
R1898:Zdhhc1 UTSW 8 105478746 splice site probably null
R2511:Zdhhc1 UTSW 8 105483558 missense probably benign 0.16
R4734:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4741:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4795:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4818:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4819:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4822:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4871:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4891:Zdhhc1 UTSW 8 105473017 missense probably benign 0.00
R4901:Zdhhc1 UTSW 8 105472852 missense probably benign
R4905:Zdhhc1 UTSW 8 105483694 missense probably damaging 0.98
R4953:Zdhhc1 UTSW 8 105483744 frame shift probably null
R5274:Zdhhc1 UTSW 8 105483770 missense probably benign 0.30
R5380:Zdhhc1 UTSW 8 105483744 frame shift probably null
R5381:Zdhhc1 UTSW 8 105483744 frame shift probably null
R6852:Zdhhc1 UTSW 8 105477072 missense possibly damaging 0.70
R6962:Zdhhc1 UTSW 8 105483647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACATGCACCCAGCTTCAG -3'
(R):5'- CCTGCTAAATCCTGGCTGTAGC -3'

Sequencing Primer
(F):5'- CAAGGATACAGCATAGCCA -3'
(R):5'- ATCGGACCTTTTTAGGCCTAATG -3'
Posted On2016-06-21