Incidental Mutation 'R5128:Olfr143'
ID394864
Institutional Source Beutler Lab
Gene Symbol Olfr143
Ensembl Gene ENSMUSG00000094778
Gene Nameolfactory receptor 143
SynonymsK18, GA_x6K02T2PVTD-31941084-31942025, MOR170-6
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38252774-38256549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38253570 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 48 (L48P)
Ref Sequence ENSEMBL: ENSMUSP00000149842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093865] [ENSMUST00000212354] [ENSMUST00000213129]
Predicted Effect probably damaging
Transcript: ENSMUST00000093865
AA Change: L51P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091388
Gene: ENSMUSG00000094778
AA Change: L51P

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 1e-49 PFAM
Pfam:7tm_1 44 293 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212354
AA Change: L48P
Predicted Effect probably damaging
Transcript: ENSMUST00000213129
AA Change: L48P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Olfr143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02269:Olfr143 APN 9 38253936 missense possibly damaging 0.82
R0417:Olfr143 UTSW 9 38253864 missense probably benign 0.03
R1191:Olfr143 UTSW 9 38254205 missense probably damaging 0.99
R1863:Olfr143 UTSW 9 38253720 missense probably damaging 0.99
R1868:Olfr143 UTSW 9 38253690 missense probably damaging 1.00
R2252:Olfr143 UTSW 9 38253830 missense probably benign
R7254:Olfr143 UTSW 9 38253423 missense probably benign 0.04
R7455:Olfr143 UTSW 9 38254254 missense probably damaging 0.98
R7504:Olfr143 UTSW 9 38254243 missense possibly damaging 0.60
R7881:Olfr143 UTSW 9 38254110 missense probably benign 0.31
R7964:Olfr143 UTSW 9 38254110 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CTCTTGGAGTAAATGATGGCTTATG -3'
(R):5'- ATAGGCCATGGCTGTCAACAC -3'

Sequencing Primer
(F):5'- AATGATGGCTTATGGGTTAATATTGC -3'
(R):5'- TGGCTGTCAACACATAACTCTCAGAG -3'
Posted On2016-06-21