Incidental Mutation 'R5128:Arhgap45'
ID394866
Institutional Source Beutler Lab
Gene Symbol Arhgap45
Ensembl Gene ENSMUSG00000035697
Gene NameRho GTPase activating protein 45
Synonyms6330406L22Rik, Hmha1
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80016653-80031472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80030959 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1099 (T1099A)
Ref Sequence ENSEMBL: ENSMUSP00000101012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004786] [ENSMUST00000043311] [ENSMUST00000099501] [ENSMUST00000105373]
Predicted Effect probably benign
Transcript: ENSMUST00000004786
SMART Domains Protein: ENSMUSP00000004786
Gene: ENSMUSG00000004667

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb5_N 4 94 3.2e-38 PFAM
Pfam:RNA_pol_Rpb5_C 137 209 6.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043311
AA Change: T972A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697
AA Change: T972A

DomainStartEndE-ValueType
low complexity region 142 153 N/A INTRINSIC
FCH 157 244 4.14e-17 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 330 345 N/A INTRINSIC
low complexity region 527 536 N/A INTRINSIC
C1 582 628 3.15e-8 SMART
RhoGAP 653 852 2.73e-73 SMART
low complexity region 856 869 N/A INTRINSIC
Blast:RhoGAP 876 999 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000099501
AA Change: T1088A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: T1088A

DomainStartEndE-ValueType
low complexity region 258 269 N/A INTRINSIC
FCH 273 360 4.14e-17 SMART
low complexity region 371 385 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 446 461 N/A INTRINSIC
low complexity region 643 652 N/A INTRINSIC
C1 698 744 3.15e-8 SMART
RhoGAP 769 968 2.73e-73 SMART
low complexity region 972 985 N/A INTRINSIC
Blast:RhoGAP 992 1115 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105373
AA Change: T1099A

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: T1099A

DomainStartEndE-ValueType
low complexity region 269 280 N/A INTRINSIC
FCH 284 371 4.14e-17 SMART
low complexity region 382 396 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
low complexity region 654 663 N/A INTRINSIC
C1 709 755 3.15e-8 SMART
RhoGAP 780 979 2.73e-73 SMART
low complexity region 983 996 N/A INTRINSIC
Blast:RhoGAP 1003 1126 1e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150022
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Arhgap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Arhgap45 APN 10 80028648 splice site probably benign
IGL01414:Arhgap45 APN 10 80027104 missense probably damaging 1.00
IGL01505:Arhgap45 APN 10 80026542 missense probably benign 0.10
IGL02203:Arhgap45 APN 10 80027553 nonsense probably null
IGL02557:Arhgap45 APN 10 80021638 missense probably damaging 1.00
IGL02858:Arhgap45 APN 10 80017934 missense probably benign 0.20
IGL03292:Arhgap45 APN 10 80020969 missense probably benign 0.04
IGL03352:Arhgap45 APN 10 80030751 missense probably damaging 0.96
Celt UTSW 10 80020818 missense probably damaging 1.00
druid UTSW 10 80026347 critical splice donor site probably null
Mistletoe UTSW 10 80027102 nonsense probably null
Roman UTSW 10 80027597 missense probably damaging 1.00
stonehenge UTSW 10 80025482 missense possibly damaging 0.81
IGL03048:Arhgap45 UTSW 10 80017017 missense probably damaging 0.99
PIT4677001:Arhgap45 UTSW 10 80020749 missense probably benign
R0532:Arhgap45 UTSW 10 80022083 missense possibly damaging 0.92
R1233:Arhgap45 UTSW 10 80027582 missense probably damaging 1.00
R1579:Arhgap45 UTSW 10 80028977 missense probably damaging 1.00
R1666:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1668:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1688:Arhgap45 UTSW 10 80029095 missense probably damaging 1.00
R1710:Arhgap45 UTSW 10 80018098 nonsense probably null
R1902:Arhgap45 UTSW 10 80025466 missense probably damaging 0.99
R1912:Arhgap45 UTSW 10 80020690 missense probably benign 0.08
R1935:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1936:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1955:Arhgap45 UTSW 10 80026492 missense probably benign 0.15
R1968:Arhgap45 UTSW 10 80027702 missense probably damaging 1.00
R1977:Arhgap45 UTSW 10 80020818 missense probably damaging 1.00
R1986:Arhgap45 UTSW 10 80020696 missense probably damaging 1.00
R2074:Arhgap45 UTSW 10 80027180 missense probably damaging 1.00
R2081:Arhgap45 UTSW 10 80027674 missense probably damaging 1.00
R2162:Arhgap45 UTSW 10 80016979 start codon destroyed probably null 0.02
R2937:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R2938:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R3081:Arhgap45 UTSW 10 80026447 missense probably damaging 1.00
R4695:Arhgap45 UTSW 10 80025530 missense probably damaging 1.00
R4736:Arhgap45 UTSW 10 80026172 missense probably damaging 1.00
R4758:Arhgap45 UTSW 10 80030293 missense probably benign 0.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4934:Arhgap45 UTSW 10 80020957 missense probably damaging 1.00
R4943:Arhgap45 UTSW 10 80026503 missense probably benign 0.00
R5102:Arhgap45 UTSW 10 80021428 missense probably benign 0.01
R5667:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5671:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5920:Arhgap45 UTSW 10 80029131 missense possibly damaging 0.87
R5998:Arhgap45 UTSW 10 80030950 missense probably damaging 0.99
R6276:Arhgap45 UTSW 10 80026234 missense probably benign 0.25
R6675:Arhgap45 UTSW 10 80018104 missense probably null 0.98
R6738:Arhgap45 UTSW 10 80027597 missense probably damaging 1.00
R6783:Arhgap45 UTSW 10 80017864 missense possibly damaging 0.92
R6863:Arhgap45 UTSW 10 80017782 missense probably benign 0.03
R6978:Arhgap45 UTSW 10 80021848 missense probably benign 0.00
R7089:Arhgap45 UTSW 10 80026347 critical splice donor site probably null
R7215:Arhgap45 UTSW 10 80025482 missense possibly damaging 0.81
R7307:Arhgap45 UTSW 10 80029182 missense probably benign 0.14
R7308:Arhgap45 UTSW 10 80026558 critical splice donor site probably null
R7480:Arhgap45 UTSW 10 80027102 nonsense probably null
R7481:Arhgap45 UTSW 10 80022300 missense possibly damaging 0.80
R7649:Arhgap45 UTSW 10 80031001 missense probably benign 0.00
R7652:Arhgap45 UTSW 10 80028838 missense probably benign 0.01
R7748:Arhgap45 UTSW 10 80016932 unclassified probably benign
R7883:Arhgap45 UTSW 10 80027589 nonsense probably null
R7966:Arhgap45 UTSW 10 80027589 nonsense probably null
X0023:Arhgap45 UTSW 10 80030800 missense probably damaging 0.98
X0063:Arhgap45 UTSW 10 80030356 missense possibly damaging 0.51
Z1176:Arhgap45 UTSW 10 80025536
Z1176:Arhgap45 UTSW 10 80029052
Predicted Primers PCR Primer
(F):5'- TCTCACGCGGCATCTAATG -3'
(R):5'- AAGTTCCTCGGCATTGTGAG -3'

Sequencing Primer
(F):5'- GCATCTAATGACTCGGACTCTGAG -3'
(R):5'- ACATTGAGCTGATGGTCC -3'
Posted On2016-06-21