Incidental Mutation 'R5128:Inhbc'
ID394868
Institutional Source Beutler Lab
Gene Symbol Inhbc
Ensembl Gene ENSMUSG00000025405
Gene Nameinhibin beta-C
Synonymsactivin
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127356322-127370431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127357742 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 135 (M135K)
Ref Sequence ENSEMBL: ENSMUSP00000026472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026472] [ENSMUST00000059718]
Predicted Effect probably benign
Transcript: ENSMUST00000026472
AA Change: M135K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026472
Gene: ENSMUSG00000025405
AA Change: M135K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TGFB 247 352 7.32e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059718
SMART Domains Protein: ENSMUSP00000053977
Gene: ENSMUSG00000047492

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
TGFB 247 350 3.63e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Meta Mutation Damage Score 0.3489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of homodimeric and heterodimeric activin complexes. The heterodimeric complex may function in the inhibition of activin A signaling. Transgenic mice overexpressing this gene exhibit defects in testis, liver and prostate. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null mutation display decreased serum albumin in females but are fertile with normal liver and reproductive morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Inhbc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Inhbc APN 10 127370099 missense probably damaging 1.00
IGL02114:Inhbc APN 10 127370102 missense probably benign 0.00
LCD18:Inhbc UTSW 10 127367140 intron probably benign
R0042:Inhbc UTSW 10 127357433 missense probably benign 0.17
R0760:Inhbc UTSW 10 127357368 missense probably damaging 1.00
R1339:Inhbc UTSW 10 127357641 missense probably benign
R1754:Inhbc UTSW 10 127370293 missense possibly damaging 0.84
R1867:Inhbc UTSW 10 127357547 missense probably benign 0.01
R2902:Inhbc UTSW 10 127357752 missense probably benign
R4622:Inhbc UTSW 10 127357277 missense probably benign 0.26
R5285:Inhbc UTSW 10 127357400 missense probably damaging 1.00
R5423:Inhbc UTSW 10 127357427 missense probably damaging 1.00
R5807:Inhbc UTSW 10 127357542 nonsense probably null
R5815:Inhbc UTSW 10 127357449 missense probably benign 0.01
R6483:Inhbc UTSW 10 127357440 nonsense probably null
R7423:Inhbc UTSW 10 127357406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGATCAAGGAACTGTGGG -3'
(R):5'- GGTATGCTGAGAACAGAGGC -3'

Sequencing Primer
(F):5'- TACCAGCTCCAGAGTAAGGTGTC -3'
(R):5'- AACAGAGGCGGCTGGTC -3'
Posted On2016-06-21