Incidental Mutation 'R5128:Pafah1b1'
ID394872
Institutional Source Beutler Lab
Gene Symbol Pafah1b1
Ensembl Gene ENSMUSG00000020745
Gene Nameplatelet-activating factor acetylhydrolase, isoform 1b, subunit 1
SynonymsPafaha, lissencephaly-1 protein, Mdsh, PAF-AH 45, LIS-1, Lis1
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74673949-74724670 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 74679436 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021091] [ENSMUST00000102520]
Predicted Effect probably benign
Transcript: ENSMUST00000021091
SMART Domains Protein: ENSMUSP00000021091
Gene: ENSMUSG00000020745

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102520
SMART Domains Protein: ENSMUSP00000099578
Gene: ENSMUSG00000020745

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156794
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus was identified as encoding a gene that when mutated or lost caused the lissencephaly associated with Miller-Dieker lissencephaly syndrome. This gene encodes the non-catalytic alpha subunit of the intracellular Ib isoform of platelet-activating factor acteylhydrolase, a heterotrimeric enzyme that specifically catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist: one composed of multiple subunits, the other, a single subunit. In addition, a single-subunit isoform of this enzyme is found in serum. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mutations at this locus result in neuronal migration defects. Homozygous null mutants die around implantation. Different allelic combinations show variable cortical, hippocampal and olfactory disorganization and impaired spatial learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Pafah1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pafah1b1 APN 11 74683647 missense probably damaging 1.00
IGL01861:Pafah1b1 APN 11 74690577 missense possibly damaging 0.81
IGL02082:Pafah1b1 APN 11 74699333 missense probably benign 0.33
IGL03180:Pafah1b1 APN 11 74683518 missense possibly damaging 0.80
hotspur UTSW 11 74682272 missense probably benign 0.02
picador UTSW 11 74677731 missense probably benign
R0362:Pafah1b1 UTSW 11 74683631 missense probably benign 0.01
R0462:Pafah1b1 UTSW 11 74677715 missense probably benign 0.00
R1962:Pafah1b1 UTSW 11 74699351 start gained probably benign
R3176:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3276:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3615:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3616:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R4326:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4327:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4328:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4776:Pafah1b1 UTSW 11 74685871 unclassified probably benign
R4985:Pafah1b1 UTSW 11 74685988 missense probably damaging 1.00
R5148:Pafah1b1 UTSW 11 74684452 missense probably damaging 0.99
R6406:Pafah1b1 UTSW 11 74682272 missense probably benign 0.02
R6437:Pafah1b1 UTSW 11 74677731 missense probably benign
R7229:Pafah1b1 UTSW 11 74682278 missense probably damaging 0.99
R7480:Pafah1b1 UTSW 11 74685914 missense probably damaging 1.00
X0064:Pafah1b1 UTSW 11 74689183 missense possibly damaging 0.62
Z1176:Pafah1b1 UTSW 11 74689119 missense not run
Z1176:Pafah1b1 UTSW 11 74690241 missense not run
Predicted Primers PCR Primer
(F):5'- ACCAGCCAGTCAATAGGAGTG -3'
(R):5'- ATAACTGGGTACGTGGAGTTC -3'

Sequencing Primer
(F):5'- GTCGTTTCCAAACCCAATGC -3'
(R):5'- ACGTGGAGTTCTGTTCCATTC -3'
Posted On2016-06-21