Mutagenetix > Incidental Mutations

Incidental Mutation 'R5128:Pip4k2b'

394873

Institutional Source

Beutler Lab

Gene Symbol

Pip4k2b

Ensembl Gene

ENSMUSG00000018547

Gene Name

phosphatidylinositol-5-phosphate 4-kinase, type II, beta

Synonyms

Pip5k2b, PI5P4Kbeta, c11

MMRRC Submission

042716-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.241) question?

Stock #

R5128 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97715157-97744704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97718876 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 412 (S412P)

Ref Sequence

ENSEMBL: ENSMUSP00000018691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018691]

Predicted Effect

probably benign
Transcript: ENSMUST00000018691
AA Change: S412P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000018691
Gene: ENSMUSG00000018547
AA Change: S412P

Domain	Start	End	E-Value	Type
PIPKc	67	416	4.49e-156	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137598

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144012

Meta Mutation Damage Score

0.1930

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. The encoded protein sequence does not show similarity to other kinases, but the protein does exhibit kinase activity. Additionally, the encoded protein interacts with p55 TNF receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are smaller than normal with less body fat and an increased sensitivity to insulin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	G	A	2: 111,164,329	Q251*	probably null	Het
Abcc6	A	G	7: 45,989,646	S958P	probably benign	Het
Ahnak	T	C	19: 9,017,087	L5245P	probably damaging	Het
Alg5	T	A	3: 54,742,137		probably null	Het
Anapc1	A	G	2: 128,659,917	V735A	probably benign	Het
Arhgap45	A	G	10: 80,030,959	T1099A	probably benign	Het
Cacna1e	A	C	1: 154,402,021	S2062A	probably damaging	Het
Chrna9	A	G	5: 65,971,222	S258G	probably benign	Het
Ctcfl	T	C	2: 173,117,396	E179G	probably benign	Het
Dcdc2a	C	A	13: 25,102,529	A145E	probably damaging	Het
Dgkz	A	G	2: 91,942,683	I343T	probably damaging	Het
Dnah1	T	C	14: 31,296,195		probably null	Het
Dqx1	T	C	6: 83,060,567	L374P	probably damaging	Het
Entpd5	A	T	12: 84,394,690	F101L	probably benign	Het
Esco1	A	T	18: 10,567,468		probably benign	Het
Fgf1	C	A	18: 38,842,025	V124L	probably benign	Het
Gm16380	C	T	9: 53,884,113		noncoding transcript	Het
Grid2	G	A	6: 64,665,998	A915T	probably benign	Het
Inhbc	A	T	10: 127,357,742	M135K	probably benign	Het
Mertk	C	A	2: 128,738,247	T207K	probably damaging	Het
Mroh9	C	G	1: 163,060,760	G249R	probably damaging	Het
Mtmr10	C	T	7: 64,333,439	T498I	probably damaging	Het
Muc3	A	G	5: 137,138,186		probably null	Het
Nlrp1c-ps	G	T	11: 71,279,595		noncoding transcript	Het
Nphp4	T	A	4: 152,502,991	I267N	probably benign	Het
Obox8	A	G	7: 14,332,090	W168R	probably damaging	Het
Olfr1247	A	T	2: 89,609,303	D266E	probably damaging	Het
Olfr143	T	C	9: 38,253,570	L48P	probably damaging	Het
Olfr330	A	T	11: 58,529,422	V188E	probably damaging	Het
Pafah1b1	A	G	11: 74,679,436		probably benign	Het
Palld	T	C	8: 61,720,588	T346A	probably damaging	Het
Scn3a	T	C	2: 65,508,518	S606G	probably benign	Het
Slc12a7	G	T	13: 73,805,433	S754I	probably benign	Het
Tep1	A	G	14: 50,844,279	*489R	probably null	Het
Tnn	A	T	1: 160,122,894	V714E	probably damaging	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Ttc16	T	A	2: 32,762,997	I550F	probably benign	Het
Vit	T	C	17: 78,625,146	S561P	probably damaging	Het
Zdhhc1	T	A	8: 105,483,636	I50F	probably benign	Het
Zfp451	C	T	1: 33,802,933		probably benign	Het
Zfp597	G	A	16: 3,872,124		probably benign	Het

Other mutations in Pip4k2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Pip4k2b	APN	11	97744505	missense	probably damaging	1.00
IGL01567:Pip4k2b	APN	11	97729561	missense	probably damaging	0.99
IGL01568:Pip4k2b	APN	11	97729552	critical splice donor site	probably null
IGL03004:Pip4k2b	APN	11	97724474	missense	probably damaging	1.00
bigun	UTSW	11	97722936	splice site	probably benign
yuge	UTSW	11	97722434	missense	probably benign	0.04
R0119:Pip4k2b	UTSW	11	97722936	splice site	probably benign
R0657:Pip4k2b	UTSW	11	97722936	splice site	probably benign
R1223:Pip4k2b	UTSW	11	97718894	missense	probably damaging	1.00
R1252:Pip4k2b	UTSW	11	97744594	missense	probably benign	0.45
R2914:Pip4k2b	UTSW	11	97722434	missense	probably benign	0.04
R3702:Pip4k2b	UTSW	11	97729548	splice site	probably benign
R4173:Pip4k2b	UTSW	11	97722375	missense	probably benign	0.06
R4998:Pip4k2b	UTSW	11	97722435	missense	possibly damaging	0.49
R5084:Pip4k2b	UTSW	11	97719743	missense	probably damaging	1.00
R6590:Pip4k2b	UTSW	11	97729567	missense	probably damaging	1.00
R6690:Pip4k2b	UTSW	11	97729567	missense	probably damaging	1.00
R7104:Pip4k2b	UTSW	11	97732716	missense	possibly damaging	0.83
R7676:Pip4k2b	UTSW	11	97720362	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCTTCCTTCAGGTCACAGGCTG -3'
(R):5'- GTTGAGAACCAGAACCAGTAGTC -3'

Sequencing Primer
(F):5'- GGCTGCAGTCCCTTAACTAAAG -3'
(R):5'- AAGTGGTTTTTGTTGTTGTTGTTG -3'

Posted On

2016-06-21