Incidental Mutation 'R5128:Entpd5'
ID394874
Institutional Source Beutler Lab
Gene Symbol Entpd5
Ensembl Gene ENSMUSG00000021236
Gene Nameectonucleoside triphosphate diphosphohydrolase 5
SynonymsER-UDPase, Cd39l4, NTPDase-5, Pcph, NTPDase5, mNTPase
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84373857-84409029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84394690 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 101 (F101L)
Ref Sequence ENSEMBL: ENSMUSP00000071939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021662] [ENSMUST00000072061] [ENSMUST00000110272] [ENSMUST00000117286] [ENSMUST00000120942] [ENSMUST00000122194]
Predicted Effect probably benign
Transcript: ENSMUST00000021662
AA Change: F76L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021662
Gene: ENSMUSG00000021236
AA Change: F76L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072061
AA Change: F101L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071939
Gene: ENSMUSG00000021236
AA Change: F101L

DomainStartEndE-ValueType
transmembrane domain 27 46 N/A INTRINSIC
Pfam:GDA1_CD39 65 451 1.9e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110272
AA Change: F76L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105901
Gene: ENSMUSG00000021236
AA Change: F76L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117286
AA Change: F76L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114011
Gene: ENSMUSG00000021236
AA Change: F76L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120942
AA Change: F76L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112516
Gene: ENSMUSG00000021236
AA Change: F76L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122194
AA Change: F76L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113106
Gene: ENSMUSG00000021236
AA Change: F76L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to E-type nucleotidases (NTPases)/ecto-ATPase/apyrases. NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD5 contains 4 apyrase-conserved regions which is characteristic of NTPases. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele develop progressive hepatopathy, hepatocellular tumors, and spermatogenic arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Entpd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Entpd5 APN 12 84387054 missense probably damaging 1.00
IGL01455:Entpd5 APN 12 84394677 missense probably benign 0.00
IGL02168:Entpd5 APN 12 84386978 critical splice donor site probably null
IGL02183:Entpd5 APN 12 84380380 splice site probably benign
IGL03104:Entpd5 APN 12 84384248 missense probably damaging 0.97
IGL03332:Entpd5 APN 12 84382228 splice site probably null
aventi UTSW 12 84382295 nonsense probably null
eatsy UTSW 12 84382295 nonsense probably null
magenschonend UTSW 12 84394690 missense probably benign 0.00
R0024:Entpd5 UTSW 12 84373733 missense probably benign 0.01
R0103:Entpd5 UTSW 12 84396943 nonsense probably null
R0103:Entpd5 UTSW 12 84396943 nonsense probably null
R0644:Entpd5 UTSW 12 84386141 missense probably benign 0.00
R1533:Entpd5 UTSW 12 84394660 missense probably damaging 1.00
R1536:Entpd5 UTSW 12 84382295 nonsense probably null
R1740:Entpd5 UTSW 12 84396771 missense probably benign 0.01
R1768:Entpd5 UTSW 12 84386211 missense probably benign
R2049:Entpd5 UTSW 12 84396858 missense probably benign 0.00
R6562:Entpd5 UTSW 12 84386200 missense probably damaging 1.00
R6907:Entpd5 UTSW 12 84377353 missense probably benign 0.23
R7209:Entpd5 UTSW 12 84396928 missense probably benign
R7605:Entpd5 UTSW 12 84396708 missense probably damaging 1.00
X0057:Entpd5 UTSW 12 84384220 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCATGGACAGAGCTCAGC -3'
(R):5'- GAAGCAGTCTACCCTCTGACAATC -3'

Sequencing Primer
(F):5'- TGGACAGAGCTCAGCCACAG -3'
(R):5'- GCAGTCTACCCTCTGACAATCATCTC -3'
Posted On2016-06-21