Incidental Mutation 'R0449:Phlpp1'
ID39489
Institutional Source Beutler Lab
Gene Symbol Phlpp1
Ensembl Gene ENSMUSG00000044340
Gene NamePH domain and leucine rich repeat protein phosphatase 1
SynonymsPhlpp, Plekhe1
MMRRC Submission 038649-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R0449 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location106171752-106394250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106350578 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 907 (R907W)
Ref Sequence ENSEMBL: ENSMUSP00000056530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061047]
Predicted Effect probably damaging
Transcript: ENSMUST00000061047
AA Change: R907W

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340
AA Change: R907W

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 96 N/A INTRINSIC
low complexity region 97 143 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
low complexity region 257 277 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 355 369 N/A INTRINSIC
PH 493 594 3.16e-2 SMART
LRR 615 634 4.75e2 SMART
LRR 648 669 7.16e0 SMART
LRR 669 688 1.48e1 SMART
LRR 692 714 2.14e1 SMART
LRR 715 738 1.37e1 SMART
LRR 786 809 3.27e1 SMART
LRR 849 868 8.11e0 SMART
LRR 872 895 1.97e1 SMART
LRR 895 914 2.55e1 SMART
LRR 919 940 1.86e1 SMART
LRR 941 960 1.67e1 SMART
LRR 991 1010 2.13e1 SMART
LRR 1015 1038 5.11e0 SMART
PP2Cc 1121 1376 2.62e-58 SMART
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1424 1445 N/A INTRINSIC
Blast:PP2Cc 1463 1555 2e-39 BLAST
low complexity region 1608 1624 N/A INTRINSIC
low complexity region 1640 1671 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,939,885 R813* probably null Het
Accsl T A 2: 93,866,074 I60F probably benign Het
Adam29 C T 8: 55,872,681 G246D probably benign Het
Ankrd13c A G 3: 157,991,714 I319V probably benign Het
B020004J07Rik T C 4: 101,836,961 S242G probably benign Het
Bag6 T G 17: 35,141,466 V327G probably damaging Het
Barhl1 C T 2: 28,915,292 A130T probably benign Het
Bend4 T C 5: 67,398,240 D541G probably damaging Het
Birc6 A C 17: 74,692,295 T4673P probably damaging Het
Ccdc81 T C 7: 89,890,471 R186G probably damaging Het
Cdyl2 A G 8: 116,583,192 F342L probably damaging Het
Chd3 C A 11: 69,357,541 V748L probably damaging Het
CN725425 G T 15: 91,238,944 R72I possibly damaging Het
Col22a1 A G 15: 71,962,671 probably null Het
Cops3 A G 11: 59,818,417 probably null Het
Ctnnd1 G T 2: 84,603,262 Q940K possibly damaging Het
Dtnb C T 12: 3,591,971 Q45* probably null Het
Efr3a T A 15: 65,842,704 I280K probably damaging Het
Eml6 A C 11: 29,893,213 V167G probably benign Het
Fam83c T A 2: 155,830,295 M407L probably benign Het
Fasn T C 11: 120,811,068 T1862A probably benign Het
Fbxl6 A G 15: 76,535,955 I486T probably damaging Het
Gpr182 A G 10: 127,750,696 Y129H probably damaging Het
Gpr75 A G 11: 30,892,456 S454G probably damaging Het
Hectd4 G A 5: 121,364,590 probably null Het
Hsf4 A G 8: 105,275,590 T411A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il4 A T 11: 53,618,605 M1K probably null Het
Ints11 G T 4: 155,887,948 R463L probably benign Het
Ints4 G A 7: 97,529,223 E677K probably damaging Het
Klk1b11 G A 7: 43,997,792 C50Y probably damaging Het
Krt14 C A 11: 100,207,395 G21C unknown Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lama3 A G 18: 12,500,512 probably null Het
Lrrk2 T C 15: 91,750,275 L1414P probably damaging Het
Matn2 T C 15: 34,428,541 S684P probably damaging Het
Mga T A 2: 119,941,381 V1574D probably damaging Het
Mia2 T C 12: 59,172,594 probably null Het
Mrpl21 T A 19: 3,292,459 probably benign Het
Msh5 T A 17: 35,041,482 Q266L probably benign Het
Mybpc1 C A 10: 88,540,960 C758F probably damaging Het
Myo15 G A 11: 60,509,596 A2932T possibly damaging Het
Nbas T A 12: 13,519,108 I2021K probably benign Het
Neurl4 T C 11: 69,905,567 S424P probably damaging Het
Olfr16 T A 1: 172,957,398 V201E probably damaging Het
Olfr322 A C 11: 58,665,963 I135L probably benign Het
Olfr782 A G 10: 129,351,234 M224V probably benign Het
Olfr829 T C 9: 18,856,649 M8T probably benign Het
Olfr850 T A 9: 19,478,092 I53F possibly damaging Het
Pigg T C 5: 108,336,411 V508A probably benign Het
Pkhd1l1 T G 15: 44,501,519 Y685D probably damaging Het
Polr3a A T 14: 24,484,466 I34N probably damaging Het
Prex1 A G 2: 166,569,377 V1434A probably benign Het
Ptprh T A 7: 4,598,006 D124V probably damaging Het
Rad54b T A 4: 11,606,131 I513N probably benign Het
Rbm12b1 A G 4: 12,145,507 N493S probably benign Het
Rfx7 A T 9: 72,610,304 probably null Het
Serpini1 A G 3: 75,613,341 K82E probably benign Het
Slc27a6 T G 18: 58,609,165 probably null Het
Slc35f2 G T 9: 53,816,917 L358F probably damaging Het
Slc45a1 A C 4: 150,643,305 I158M probably damaging Het
Slurp2 G A 15: 74,743,106 P62L probably damaging Het
Sspo C T 6: 48,466,740 H1949Y probably damaging Het
Tiam1 A T 16: 89,837,827 V865E possibly damaging Het
Tlr4 A C 4: 66,839,620 I217L probably damaging Het
Top1 C T 2: 160,712,708 R460* probably null Het
Trpm3 T A 19: 22,988,054 S1638T probably benign Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Vars T G 17: 35,012,727 probably null Het
Xylt2 A G 11: 94,666,333 Y111H probably benign Het
Zbed5 G A 5: 129,901,726 G172D probably damaging Het
Zfp53 C T 17: 21,508,833 T376I probably benign Het
Zfp937 G T 2: 150,239,546 V499L probably benign Het
Zyx T A 6: 42,351,313 L152Q probably damaging Het
Other mutations in Phlpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Phlpp1 APN 1 106376255 missense probably damaging 1.00
IGL00848:Phlpp1 APN 1 106339448 missense probably damaging 1.00
IGL01122:Phlpp1 APN 1 106173436 missense possibly damaging 0.51
IGL01588:Phlpp1 APN 1 106380389 missense probably damaging 1.00
IGL02145:Phlpp1 APN 1 106389883 missense probably damaging 0.96
IGL02417:Phlpp1 APN 1 106392714 missense probably benign 0.00
IGL02863:Phlpp1 APN 1 106376297 splice site probably null
IGL03178:Phlpp1 APN 1 106392388 missense probably damaging 0.99
R0400:Phlpp1 UTSW 1 106392934 missense probably benign 0.35
R0423:Phlpp1 UTSW 1 106339615 missense probably benign 0.03
R0765:Phlpp1 UTSW 1 106392283 missense probably damaging 1.00
R0884:Phlpp1 UTSW 1 106389665 splice site probably null
R1394:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1395:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1428:Phlpp1 UTSW 1 106380425 splice site probably null
R1438:Phlpp1 UTSW 1 106173412 missense possibly damaging 0.53
R1521:Phlpp1 UTSW 1 106392319 missense probably damaging 1.00
R1572:Phlpp1 UTSW 1 106392789 missense probably damaging 1.00
R1588:Phlpp1 UTSW 1 106380385 missense probably damaging 1.00
R1843:Phlpp1 UTSW 1 106343505 missense probably benign 0.40
R1889:Phlpp1 UTSW 1 106318850 missense possibly damaging 0.95
R2404:Phlpp1 UTSW 1 106172839 missense probably benign 0.22
R2942:Phlpp1 UTSW 1 106172772 missense probably benign 0.00
R3774:Phlpp1 UTSW 1 106393191 small deletion probably benign
R3832:Phlpp1 UTSW 1 106392597 missense probably damaging 1.00
R4029:Phlpp1 UTSW 1 106392549 missense probably damaging 0.98
R4086:Phlpp1 UTSW 1 106347161 missense probably benign 0.03
R4112:Phlpp1 UTSW 1 106364338 missense probably damaging 1.00
R4472:Phlpp1 UTSW 1 106386446 missense probably damaging 1.00
R4654:Phlpp1 UTSW 1 106339501 missense probably benign 0.00
R4908:Phlpp1 UTSW 1 106389751 missense probably damaging 1.00
R5027:Phlpp1 UTSW 1 106281471 missense probably damaging 1.00
R5199:Phlpp1 UTSW 1 106173394 missense probably damaging 0.98
R5352:Phlpp1 UTSW 1 106172725 missense probably benign 0.07
R5508:Phlpp1 UTSW 1 106364390 missense probably benign 0.02
R5570:Phlpp1 UTSW 1 106173432 missense probably benign 0.01
R5590:Phlpp1 UTSW 1 106392927 missense possibly damaging 0.95
R5838:Phlpp1 UTSW 1 106347132 nonsense probably null
R5955:Phlpp1 UTSW 1 106364230 splice site probably null
R5992:Phlpp1 UTSW 1 106318993 nonsense probably null
R6469:Phlpp1 UTSW 1 106287103 missense probably damaging 1.00
R6821:Phlpp1 UTSW 1 106386444 missense probably damaging 0.98
R6952:Phlpp1 UTSW 1 106172479 missense probably benign 0.04
R7101:Phlpp1 UTSW 1 106172667 missense possibly damaging 0.96
R7402:Phlpp1 UTSW 1 106389690 missense probably damaging 1.00
R7425:Phlpp1 UTSW 1 106392573 missense probably benign 0.00
R7692:Phlpp1 UTSW 1 106281402 missense probably damaging 1.00
R7874:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
R7957:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAATGAACTTGTTGGCCTGCACG -3'
(R):5'- GCCTGCACAATTCATGTCTAAGGAGC -3'

Sequencing Primer
(F):5'- TGGCCTGCACGGAATTATATAATAT -3'
(R):5'- GAGCAGTGTAAGAGTTCACATCTC -3'
Posted On2013-05-23