Incidental Mutation 'R5129:Daw1'
ID394890
Institutional Source Beutler Lab
Gene Symbol Daw1
Ensembl Gene ENSMUSG00000053161
Gene Namedynein assembly factor with WDR repeat domains 1
Synonymsb2b1116Clo, 4930563E19Rik, 4933429D11Rik, Wdr69
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location83159752-83210574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83205903 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 225 (Y225H)
Ref Sequence ENSEMBL: ENSMUSP00000109063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065403] [ENSMUST00000065436] [ENSMUST00000113436] [ENSMUST00000149342]
Predicted Effect probably damaging
Transcript: ENSMUST00000065403
AA Change: Y330H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067583
Gene: ENSMUSG00000053161
AA Change: Y330H

DomainStartEndE-ValueType
WD40 81 120 1.17e-5 SMART
WD40 123 163 1.14e-8 SMART
WD40 166 205 1.95e-11 SMART
WD40 208 247 3.47e-8 SMART
WD40 250 289 2.98e-7 SMART
WD40 292 331 1.51e-8 SMART
WD40 334 373 4.87e-12 SMART
WD40 376 415 5.14e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065436
AA Change: Y225H

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067102
Gene: ENSMUSG00000053161
AA Change: Y225H

DomainStartEndE-ValueType
WD40 81 120 1.17e-5 SMART
WD40 145 184 3.37e-6 SMART
WD40 187 226 1.51e-8 SMART
WD40 229 268 4.87e-12 SMART
WD40 271 310 5.14e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113436
AA Change: Y225H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109063
Gene: ENSMUSG00000053161
AA Change: Y225H

DomainStartEndE-ValueType
WD40 81 120 1.17e-5 SMART
WD40 145 184 3.37e-6 SMART
WD40 187 226 1.51e-8 SMART
WD40 229 268 4.87e-12 SMART
WD40 271 317 7.99e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149342
SMART Domains Protein: ENSMUSP00000117796
Gene: ENSMUSG00000053161

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for an induced mutation exhibit dextrocardia associated with situs inversus totalis, overriding aorta, ventricular septal defects, and dual inferior vena cava as well as dextrogastria, hypoplastic spleen, inverted liver, lung lobation/isomerism and dyskinetic/immotile airway cilia [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Daw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Daw1 APN 1 83197236 missense probably damaging 1.00
IGL00717:Daw1 APN 1 83198179 missense probably benign 0.03
IGL01320:Daw1 APN 1 83198180 missense possibly damaging 0.82
IGL01869:Daw1 APN 1 83182244 splice site probably benign
IGL02404:Daw1 APN 1 83197231 missense probably benign 0.15
IGL02516:Daw1 APN 1 83209228 missense probably benign 0.03
IGL02608:Daw1 APN 1 83209334 nonsense probably null
IGL02992:Daw1 APN 1 83197213 splice site probably benign
IGL03015:Daw1 APN 1 83183382 splice site probably benign
IGL03099:Daw1 APN 1 83179367 critical splice donor site probably null
R0050:Daw1 UTSW 1 83180365 missense probably benign 0.01
R0631:Daw1 UTSW 1 83197260 missense probably damaging 1.00
R0711:Daw1 UTSW 1 83191338 splice site probably benign
R1420:Daw1 UTSW 1 83159827 missense possibly damaging 0.51
R1678:Daw1 UTSW 1 83183366 missense probably damaging 1.00
R1943:Daw1 UTSW 1 83209266 missense possibly damaging 0.91
R2006:Daw1 UTSW 1 83191345 missense probably damaging 1.00
R2191:Daw1 UTSW 1 83192663 missense probably benign 0.34
R4983:Daw1 UTSW 1 83187998 missense probably benign 0.38
R5282:Daw1 UTSW 1 83192698 missense probably benign
R6128:Daw1 UTSW 1 83205926 nonsense probably null
R7438:Daw1 UTSW 1 83192715 missense probably benign
Z1088:Daw1 UTSW 1 83205964 missense probably null 1.00
Z1176:Daw1 UTSW 1 83180391 missense probably damaging 0.99
Z1176:Daw1 UTSW 1 83183300 missense probably damaging 1.00
Z1176:Daw1 UTSW 1 83209255 missense probably damaging 1.00
Z1177:Daw1 UTSW 1 83210214 missense unknown
Predicted Primers PCR Primer
(F):5'- AGATAGCAAGTCATGTCCAGC -3'
(R):5'- CTGTCAGAAACATTACTTCATTGCC -3'

Sequencing Primer
(F):5'- ATAGCAAGTCATGTCCAGCCTCTTC -3'
(R):5'- GCCTGACCCATATTAATATGTTGG -3'
Posted On2016-06-21