Incidental Mutation 'R5129:Mroh9'
ID394892
Institutional Source Beutler Lab
Gene Symbol Mroh9
Ensembl Gene ENSMUSG00000071890
Gene Namemaestro heat-like repeat family member 9
Synonyms4921528O07Rik, Armc11
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163024302-163085670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 163060760 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 249 (G249R)
Ref Sequence ENSEMBL: ENSMUSP00000094365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096608]
Predicted Effect probably damaging
Transcript: ENSMUST00000096608
AA Change: G249R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094365
Gene: ENSMUSG00000071890
AA Change: G249R

DomainStartEndE-ValueType
SCOP:d1gw5b_ 231 716 2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195132
Meta Mutation Damage Score 0.1745 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Mroh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Mroh9 APN 1 163045781 missense possibly damaging 0.89
IGL00705:Mroh9 APN 1 163079503 missense probably damaging 1.00
IGL00788:Mroh9 APN 1 163024658 missense probably benign 0.06
IGL00795:Mroh9 APN 1 163060622 missense probably damaging 1.00
IGL00815:Mroh9 APN 1 163039131 missense probably damaging 1.00
IGL01025:Mroh9 APN 1 163047866 missense possibly damaging 0.67
IGL01303:Mroh9 APN 1 163080575 missense probably benign 0.00
IGL01526:Mroh9 APN 1 163055603 missense probably damaging 0.99
IGL01680:Mroh9 APN 1 163047982 splice site probably null
IGL01823:Mroh9 APN 1 163055609 missense probably benign 0.39
IGL02024:Mroh9 APN 1 163062502 missense possibly damaging 0.65
IGL02213:Mroh9 APN 1 163058079 missense probably damaging 1.00
IGL02455:Mroh9 APN 1 163075580 missense probably benign 0.03
IGL02546:Mroh9 APN 1 163080576 missense probably benign 0.04
IGL03059:Mroh9 APN 1 163024636 missense possibly damaging 0.95
IGL03061:Mroh9 APN 1 163026502 missense probably damaging 1.00
IGL03071:Mroh9 APN 1 163039197 missense probably damaging 1.00
R0048:Mroh9 UTSW 1 163062487 missense probably damaging 0.97
R0048:Mroh9 UTSW 1 163062487 missense probably damaging 0.97
R0441:Mroh9 UTSW 1 163060762 missense probably damaging 1.00
R0506:Mroh9 UTSW 1 163060636 missense possibly damaging 0.90
R0629:Mroh9 UTSW 1 163060636 missense possibly damaging 0.90
R0751:Mroh9 UTSW 1 163066124 missense possibly damaging 0.84
R1301:Mroh9 UTSW 1 163043983 critical splice donor site probably null
R1481:Mroh9 UTSW 1 163026509 missense probably damaging 1.00
R1618:Mroh9 UTSW 1 163024541 missense probably benign 0.00
R1647:Mroh9 UTSW 1 163046056 missense probably damaging 1.00
R1648:Mroh9 UTSW 1 163046056 missense probably damaging 1.00
R1668:Mroh9 UTSW 1 163024592 missense possibly damaging 0.52
R1795:Mroh9 UTSW 1 163056778 missense probably damaging 0.97
R1796:Mroh9 UTSW 1 163045710 missense probably damaging 1.00
R1857:Mroh9 UTSW 1 163039145 missense probably damaging 0.98
R1869:Mroh9 UTSW 1 163026513 missense probably damaging 0.97
R1923:Mroh9 UTSW 1 163076291 missense probably damaging 1.00
R2325:Mroh9 UTSW 1 163026530 splice site probably null
R2511:Mroh9 UTSW 1 163038945 missense probably benign 0.13
R2912:Mroh9 UTSW 1 163044003 missense probably damaging 1.00
R2913:Mroh9 UTSW 1 163044003 missense probably damaging 1.00
R2919:Mroh9 UTSW 1 163056772 missense probably damaging 1.00
R2973:Mroh9 UTSW 1 163056769 missense probably damaging 1.00
R3912:Mroh9 UTSW 1 163066069 missense probably damaging 0.97
R4034:Mroh9 UTSW 1 163080553 critical splice donor site probably null
R4551:Mroh9 UTSW 1 163044093 missense probably damaging 0.98
R4656:Mroh9 UTSW 1 163066024 missense probably damaging 1.00
R4662:Mroh9 UTSW 1 163055593 missense probably damaging 0.97
R4743:Mroh9 UTSW 1 163024492 missense probably benign 0.05
R4890:Mroh9 UTSW 1 163026524 missense probably damaging 1.00
R5128:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5147:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5157:Mroh9 UTSW 1 163044121 missense probably damaging 0.96
R5324:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5325:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5340:Mroh9 UTSW 1 163080587 start gained probably benign
R6005:Mroh9 UTSW 1 163075677 missense probably damaging 0.99
R6182:Mroh9 UTSW 1 163066043 nonsense probably null
R6414:Mroh9 UTSW 1 163074702 missense probably damaging 1.00
R6477:Mroh9 UTSW 1 163076304 missense probably damaging 1.00
R6540:Mroh9 UTSW 1 163038972 missense possibly damaging 0.87
R6541:Mroh9 UTSW 1 163058038 missense possibly damaging 0.78
R6643:Mroh9 UTSW 1 163075561 missense probably damaging 1.00
R6811:Mroh9 UTSW 1 163046041 missense possibly damaging 0.86
R6830:Mroh9 UTSW 1 163076366 missense probably benign
R7026:Mroh9 UTSW 1 163060682 missense probably benign 0.00
R7052:Mroh9 UTSW 1 163038956 missense possibly damaging 0.92
R7068:Mroh9 UTSW 1 163039181 missense probably damaging 1.00
R7350:Mroh9 UTSW 1 163076289 critical splice donor site probably null
R7545:Mroh9 UTSW 1 163074708 missense possibly damaging 0.56
R7615:Mroh9 UTSW 1 163046032 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAGACTTTTGAGAGCACGCTC -3'
(R):5'- TGCCTAATAGTACCTGGAACTTCC -3'

Sequencing Primer
(F):5'- GAGCACGCTCTGTTCTTCTTAG -3'
(R):5'- GGAACTTCCATCATCATTGCAC -3'
Posted On2016-06-21