Incidental Mutation 'R5129:Epb41l1'
ID394894
Institutional Source Beutler Lab
Gene Symbol Epb41l1
Ensembl Gene ENSMUSG00000027624
Gene Nameerythrocyte membrane protein band 4.1 like 1
SynonymsEpb4.1l1, 4.1N
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156420909-156543214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156509281 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 425 (Y425F)
Ref Sequence ENSEMBL: ENSMUSP00000099426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029155] [ENSMUST00000103135] [ENSMUST00000103136] [ENSMUST00000103137] [ENSMUST00000109572] [ENSMUST00000109574] [ENSMUST00000109577] [ENSMUST00000125153]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029155
AA Change: Y425F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029155
Gene: ENSMUSG00000027624
AA Change: Y425F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103135
AA Change: Y425F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099424
Gene: ENSMUSG00000027624
AA Change: Y425F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103136
AA Change: Y425F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099425
Gene: ENSMUSG00000027624
AA Change: Y425F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103137
AA Change: Y425F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099426
Gene: ENSMUSG00000027624
AA Change: Y425F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109572
AA Change: Y352F

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105200
Gene: ENSMUSG00000027624
AA Change: Y352F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 215 5.6e-12 SMART
FERM_C 219 309 1.2e-43 SMART
FA 311 357 9e-22 SMART
low complexity region 386 399 N/A INTRINSIC
Pfam:SAB 408 459 2.2e-21 PFAM
Pfam:4_1_CTD 514 619 1.3e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109574
AA Change: Y425F

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105202
Gene: ENSMUSG00000027624
AA Change: Y425F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 480 531 4.8e-24 PFAM
Pfam:4_1_CTD 610 718 4.9e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109577
AA Change: Y425F

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105205
Gene: ENSMUSG00000027624
AA Change: Y425F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 481 532 5.9e-24 PFAM
low complexity region 594 603 N/A INTRINSIC
Pfam:4_1_CTD 758 855 5.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125153
AA Change: Y425F

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121161
Gene: ENSMUSG00000027624
AA Change: Y425F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 492 543 7.4e-25 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144013
AA Change: Y119F
Meta Mutation Damage Score 0.1250 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Erythrocyte membrane protein band 4.1 (EPB41) is a multifunctional protein that mediates interactions between the erythrocyte cytoskeleton and the overlying plasma membrane. The encoded protein binds and stabilizes D2 and D3 dopamine receptors at the neuronal plasma membrane. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Epb41l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Epb41l1 APN 2 156525019 missense probably damaging 1.00
IGL00852:Epb41l1 APN 2 156503718 missense probably damaging 1.00
IGL02148:Epb41l1 APN 2 156511828 intron probably benign
IGL02164:Epb41l1 APN 2 156494949 splice site probably benign
IGL02515:Epb41l1 APN 2 156537013 missense probably damaging 1.00
R0787:Epb41l1 UTSW 2 156494090 missense probably damaging 0.98
R1450:Epb41l1 UTSW 2 156511825 intron probably benign
R1566:Epb41l1 UTSW 2 156521959 missense probably benign 0.06
R1759:Epb41l1 UTSW 2 156521974 missense probably benign 0.06
R1812:Epb41l1 UTSW 2 156496511 missense probably damaging 1.00
R1908:Epb41l1 UTSW 2 156510817 missense possibly damaging 0.80
R2152:Epb41l1 UTSW 2 156514128 missense probably damaging 1.00
R3023:Epb41l1 UTSW 2 156514209 missense probably damaging 0.99
R4178:Epb41l1 UTSW 2 156521557 missense probably benign
R4491:Epb41l1 UTSW 2 156522168 missense probably benign 0.00
R4610:Epb41l1 UTSW 2 156509261 missense possibly damaging 0.71
R4770:Epb41l1 UTSW 2 156529424 missense probably benign 0.00
R5038:Epb41l1 UTSW 2 156521410 missense probably benign 0.12
R5049:Epb41l1 UTSW 2 156524939 missense possibly damaging 0.95
R5624:Epb41l1 UTSW 2 156533771 splice site probably benign
R5780:Epb41l1 UTSW 2 156496525 missense probably damaging 1.00
R5810:Epb41l1 UTSW 2 156499655 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156503788 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156524983 missense probably benign
R5961:Epb41l1 UTSW 2 156521786 missense probably benign 0.25
R6118:Epb41l1 UTSW 2 156522477 missense probably benign 0.13
R6496:Epb41l1 UTSW 2 156533796 missense possibly damaging 0.92
R6861:Epb41l1 UTSW 2 156525222 missense probably benign
R6959:Epb41l1 UTSW 2 156499587 missense probably benign 0.03
R7009:Epb41l1 UTSW 2 156534683 splice site probably null
R7036:Epb41l1 UTSW 2 156529402 missense probably benign
R7046:Epb41l1 UTSW 2 156526892 missense possibly damaging 0.56
R7263:Epb41l1 UTSW 2 156495123 critical splice donor site probably null
R7322:Epb41l1 UTSW 2 156503851 missense probably damaging 0.98
R7398:Epb41l1 UTSW 2 156534762 missense probably damaging 1.00
X0065:Epb41l1 UTSW 2 156509277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGGGCCTGGAAATACAAG -3'
(R):5'- TGGTGCAAATGACCTTGAAGC -3'

Sequencing Primer
(F):5'- GGAAATACAAGTTTGGTTCCTACCCC -3'
(R):5'- GTGCAAATGACCTTGAAGCATCCTC -3'
Posted On2016-06-21