Mutagenetix > Incidental Mutations

Incidental Mutation 'R5129:Hectd4'

394897

Institutional Source

Beutler Lab

Gene Symbol

Hectd4

Ensembl Gene

ENSMUSG00000042744

Gene Name

HECT domain E3 ubiquitin protein ligase 4

Synonyms

Gm15800

MMRRC Submission

042717-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.902) question?

Stock #

R5129 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121220219-121368577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121343510 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 3041 (V3041M)

Ref Sequence

ENSEMBL: ENSMUSP00000048345 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042614]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042614
AA Change: V3041M

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: V3041M

Domain	Start	End	E-Value	Type
low complexity region	224	234	N/A	INTRINSIC
low complexity region	266	282	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	725	735	N/A	INTRINSIC
low complexity region	1252	1265	N/A	INTRINSIC
coiled coil region	1372	1398	N/A	INTRINSIC
low complexity region	1551	1562	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1892	1904	N/A	INTRINSIC
low complexity region	2656	2666	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC
low complexity region	2901	2917	N/A	INTRINSIC
low complexity region	2921	2933	N/A	INTRINSIC
low complexity region	3232	3246	N/A	INTRINSIC
low complexity region	3275	3335	N/A	INTRINSIC
low complexity region	3441	3448	N/A	INTRINSIC
low complexity region	3473	3506	N/A	INTRINSIC
low complexity region	3512	3533	N/A	INTRINSIC
low complexity region	3540	3554	N/A	INTRINSIC
low complexity region	3794	3822	N/A	INTRINSIC
HECTc	4048	4412	4.78e-11	SMART

Meta Mutation Damage Score

0.1842

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

98% (51/52)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,561,361		noncoding transcript	Het
Abcf1	C	T	17: 35,960,795		probably benign	Het
Adamts14	T	A	10: 61,249,618	D209V	probably benign	Het
Aldh3b1	A	G	19: 3,915,336	F392L	probably benign	Het
Atp1a2	A	T	1: 172,275,955	D999E	probably benign	Het
Capn7	T	C	14: 31,344,511	V94A	probably damaging	Het
Cdh13	A	G	8: 119,095,215	D271G	probably damaging	Het
Cntnap5b	G	A	1: 100,379,090	G844D	probably damaging	Het
Col6a4	T	C	9: 106,013,377	E1906G	probably damaging	Het
Daw1	T	C	1: 83,205,903	Y225H	probably damaging	Het
Dvl3	T	A	16: 20,517,340	M49K	possibly damaging	Het
Eef1b2	T	G	1: 63,179,580	S175A	probably damaging	Het
Epb41l1	A	T	2: 156,509,281	Y425F	possibly damaging	Het
Fam43b	A	T	4: 138,395,472	L179*	probably null	Het
Fbxw28	A	G	9: 109,326,603	L314P	probably damaging	Het
Fstl4	C	A	11: 53,186,439	D674E	probably damaging	Het
G3bp1	T	C	11: 55,489,116	V92A	possibly damaging	Het
Gm3604	A	T	13: 62,369,774	Y257N	probably benign	Het
Gm5415	C	A	1: 32,545,479	R450M	probably damaging	Het
Gm5415	T	A	1: 32,545,480	R450W	probably damaging	Het
Gm5900	A	G	7: 104,950,016		noncoding transcript	Het
Hivep2	A	G	10: 14,130,864	K1069E	probably damaging	Het
Hlf	T	C	11: 90,390,252	D38G	probably benign	Het
Hsd3b7	C	A	7: 127,801,134	C18*	probably null	Het
Kdm5a	T	C	6: 120,405,022	C676R	probably damaging	Het
Klhdc7b	A	G	15: 89,388,548	Y1211C	probably damaging	Het
Krt78	C	A	15: 101,947,580	V599L	possibly damaging	Het
Mroh9	C	G	1: 163,060,760	G249R	probably damaging	Het
Nbas	T	C	12: 13,390,960	L1097P	probably damaging	Het
Nf2	A	C	11: 4,816,145	D87E	probably benign	Het
Olfr113	T	C	17: 37,575,180	Y81C	probably damaging	Het
Olfr961	T	A	9: 39,647,494	I256N	probably benign	Het
Ppil3	A	G	1: 58,440,833		probably benign	Het
Prrc2a	T	C	17: 35,160,178	E276G	unknown	Het
Spata16	A	G	3: 26,667,564	E78G	probably damaging	Het
Tlr3	A	T	8: 45,402,981	I54K	probably damaging	Het
Tmem72	A	G	6: 116,702,013	L34P	probably damaging	Het
Triobp	A	G	15: 78,961,096	R213G	probably benign	Het
Tyrp1	T	A	4: 80,846,607	V7D	probably damaging	Het
Uhrf2	A	G	19: 30,075,221	I372V	probably benign	Het
Uty	T	C	Y: 1,158,592	T484A	probably benign	Het
Vcan	T	C	13: 89,690,240	D2395G	probably damaging	Het
Vmn1r225	T	A	17: 20,503,116	I273N	probably damaging	Het
Zfp451	C	T	1: 33,802,933		probably benign	Het
Zfp457	T	C	13: 67,293,356	E385G	probably benign	Het
Zfp74	C	T	7: 29,932,455	M121I	probably benign	Het
Zfp866	A	T	8: 69,767,709		probably null	Het
Zfp874a	A	T	13: 67,442,981	C195S	probably damaging	Het

Other mutations in Hectd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Hectd4	APN	5	121363870	missense	possibly damaging	0.51
IGL00976:Hectd4	APN	5	121349106	missense	probably benign	0.18
IGL01085:Hectd4	APN	5	121331701	missense	probably damaging	1.00
IGL01112:Hectd4	APN	5	121306950	missense	probably benign	0.01
IGL01402:Hectd4	APN	5	121339417	splice site	probably benign
IGL01474:Hectd4	APN	5	121336649	missense	possibly damaging	0.53
IGL01503:Hectd4	APN	5	121318651	missense	probably benign	0.28
IGL01548:Hectd4	APN	5	121364660	missense	possibly damaging	0.71
IGL01656:Hectd4	APN	5	121322700	missense	probably damaging	0.99
IGL01756:Hectd4	APN	5	121344824	missense	probably benign	0.28
IGL01819:Hectd4	APN	5	121328418	missense	possibly damaging	0.85
IGL02080:Hectd4	APN	5	121366606	utr 3 prime	probably benign
IGL02488:Hectd4	APN	5	121292087	missense	probably benign	0.33
IGL02490:Hectd4	APN	5	121318613	missense	possibly damaging	0.82
IGL02558:Hectd4	APN	5	121344785	missense	probably benign	0.28
IGL02626:Hectd4	APN	5	121353881	missense	possibly damaging	0.86
IGL02649:Hectd4	APN	5	121349402	missense	possibly damaging	0.73
IGL02736:Hectd4	APN	5	121342719	missense	possibly damaging	0.73
IGL02861:Hectd4	APN	5	121307004	missense	possibly damaging	0.81
IGL02880:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02889:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02953:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02969:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03031:Hectd4	APN	5	121348794	missense	possibly damaging	0.96
IGL03066:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03160:Hectd4	APN	5	121259879	missense	probably benign
IGL03181:Hectd4	APN	5	121353958	missense	possibly damaging	0.91
IGL03265:Hectd4	APN	5	121259939	splice site	probably benign
IGL03375:Hectd4	APN	5	121328382	missense	possibly damaging	0.72
PIT4466001:Hectd4	UTSW	5	121333060	critical splice donor site	probably null
R0018:Hectd4	UTSW	5	121254179	missense	possibly damaging	0.53
R0024:Hectd4	UTSW	5	121308576	missense	possibly damaging	0.92
R0030:Hectd4	UTSW	5	121262588	nonsense	probably null
R0080:Hectd4	UTSW	5	121349372	missense	probably benign	0.18
R0110:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0110:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0115:Hectd4	UTSW	5	121295506	splice site	probably benign
R0128:Hectd4	UTSW	5	121349243	missense	possibly damaging	0.86
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0132:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0244:Hectd4	UTSW	5	121329605	missense	probably benign	0.33
R0281:Hectd4	UTSW	5	121254251	missense	possibly damaging	0.85
R0329:Hectd4	UTSW	5	121259864	missense	probably benign
R0410:Hectd4	UTSW	5	121286266	missense	possibly damaging	0.86
R0422:Hectd4	UTSW	5	121343082	splice site	probably null
R0442:Hectd4	UTSW	5	121323982	missense	possibly damaging	0.66
R0449:Hectd4	UTSW	5	121364590	synonymous	probably null
R0469:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0469:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0481:Hectd4	UTSW	5	121295506	splice site	probably benign
R0510:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0510:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0520:Hectd4	UTSW	5	121331707	missense	possibly damaging	0.53
R0534:Hectd4	UTSW	5	121348476	missense	possibly damaging	0.96
R0603:Hectd4	UTSW	5	121304337	missense	possibly damaging	0.46
R0617:Hectd4	UTSW	5	121343232	splice site	probably benign
R0622:Hectd4	UTSW	5	121348625	missense	possibly damaging	0.53
R0626:Hectd4	UTSW	5	121277824	missense	probably benign	0.18
R0708:Hectd4	UTSW	5	121286463	critical splice donor site	probably null
R0710:Hectd4	UTSW	5	121336628	missense	probably benign	0.08
R0763:Hectd4	UTSW	5	121307033	unclassified	probably benign
R0764:Hectd4	UTSW	5	121286769	missense	possibly damaging	0.46
R1123:Hectd4	UTSW	5	121286736	missense	probably damaging	0.96
R1129:Hectd4	UTSW	5	121310599	missense	possibly damaging	0.66
R1204:Hectd4	UTSW	5	121350485	missense	possibly damaging	0.85
R1237:Hectd4	UTSW	5	121321507	missense	possibly damaging	0.90
R1257:Hectd4	UTSW	5	121318624	nonsense	probably null
R1391:Hectd4	UTSW	5	121353695	missense	possibly damaging	0.96
R1395:Hectd4	UTSW	5	121328513	critical splice donor site	probably null
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1545:Hectd4	UTSW	5	121323956	missense	possibly damaging	0.87
R1553:Hectd4	UTSW	5	121349259	missense	probably benign	0.00
R1572:Hectd4	UTSW	5	121301878	missense	possibly damaging	0.85
R1662:Hectd4	UTSW	5	121317245	missense	probably benign	0.01
R1705:Hectd4	UTSW	5	121298104	missense	probably benign
R1715:Hectd4	UTSW	5	121344818	missense	possibly damaging	0.85
R1728:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1736:Hectd4	UTSW	5	121349530	missense	possibly damaging	0.53
R1768:Hectd4	UTSW	5	121358303	missense	possibly damaging	0.70
R1775:Hectd4	UTSW	5	121291191	splice site	probably benign
R1784:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1843:Hectd4	UTSW	5	121297180	missense	possibly damaging	0.53
R1914:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R1915:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R2024:Hectd4	UTSW	5	121281918	missense	possibly damaging	0.86
R2103:Hectd4	UTSW	5	121355629	missense	probably benign	0.04
R2108:Hectd4	UTSW	5	121333424	missense	possibly damaging	0.72
R2124:Hectd4	UTSW	5	121318639	missense	probably damaging	0.97
R2150:Hectd4	UTSW	5	121253858	splice site	probably benign
R2192:Hectd4	UTSW	5	121315143	missense	possibly damaging	0.46
R2301:Hectd4	UTSW	5	121353537	missense	probably benign	0.18
R2324:Hectd4	UTSW	5	121315437	missense	probably damaging	1.00
R2331:Hectd4	UTSW	5	121320026	missense	probably benign	0.05
R2504:Hectd4	UTSW	5	121220620	missense	unknown
R2504:Hectd4	UTSW	5	121263967	missense	possibly damaging	0.73
R2904:Hectd4	UTSW	5	121292724	splice site	probably benign
R3843:Hectd4	UTSW	5	121259873	missense	possibly damaging	0.72
R3934:Hectd4	UTSW	5	121320101	critical splice donor site	probably null
R3944:Hectd4	UTSW	5	121303525	splice site	probably benign
R4133:Hectd4	UTSW	5	121277834	critical splice donor site	probably null
R4271:Hectd4	UTSW	5	121220504	small deletion	probably benign
R4413:Hectd4	UTSW	5	121350481	missense	possibly damaging	0.53
R4456:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R4489:Hectd4	UTSW	5	121286257	missense	possibly damaging	0.73
R4539:Hectd4	UTSW	5	121314907	nonsense	probably null
R4564:Hectd4	UTSW	5	121350431	missense	probably benign	0.33
R4582:Hectd4	UTSW	5	121286419	missense	possibly damaging	0.53
R4629:Hectd4	UTSW	5	121297203	missense	probably benign	0.01
R4633:Hectd4	UTSW	5	121349216	missense	probably benign	0.33
R4643:Hectd4	UTSW	5	121349055	missense	possibly damaging	0.53
R4679:Hectd4	UTSW	5	121325251	missense	possibly damaging	0.72
R4681:Hectd4	UTSW	5	121303615	missense	possibly damaging	0.86
R4734:Hectd4	UTSW	5	121341977	missense	possibly damaging	0.53
R4739:Hectd4	UTSW	5	121348442	missense	probably benign
R4781:Hectd4	UTSW	5	121306107	critical splice donor site	probably null
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4869:Hectd4	UTSW	5	121322672	missense	possibly damaging	0.46
R4909:Hectd4	UTSW	5	121263891	missense	probably benign	0.18
R4922:Hectd4	UTSW	5	121359315	missense	possibly damaging	0.86
R4925:Hectd4	UTSW	5	121322690	missense	possibly damaging	0.83
R5004:Hectd4	UTSW	5	121328199	unclassified	probably null
R5004:Hectd4	UTSW	5	121329565	missense	possibly damaging	0.93
R5217:Hectd4	UTSW	5	121353551	missense	possibly damaging	0.53
R5267:Hectd4	UTSW	5	121344824	missense	probably benign	0.28
R5344:Hectd4	UTSW	5	121343676	missense	probably benign	0.28
R5345:Hectd4	UTSW	5	121263974	missense	possibly damaging	0.85
R5347:Hectd4	UTSW	5	121304448	missense	probably benign	0.33
R5360:Hectd4	UTSW	5	121315401	missense	possibly damaging	0.90
R5363:Hectd4	UTSW	5	121310603	missense	probably benign	0.04
R5445:Hectd4	UTSW	5	121266274	missense	probably benign	0.00
R5479:Hectd4	UTSW	5	121306948	missense	probably benign
R5507:Hectd4	UTSW	5	121281101	missense	unknown
R5552:Hectd4	UTSW	5	121342851	missense	possibly damaging	0.96
R5691:Hectd4	UTSW	5	121348815	missense	possibly damaging	0.85
R5745:Hectd4	UTSW	5	121353502	missense	possibly damaging	0.96
R5757:Hectd4	UTSW	5	121348619	missense	possibly damaging	0.72
R5845:Hectd4	UTSW	5	121307524	critical splice donor site	probably null
R5869:Hectd4	UTSW	5	121343225	critical splice donor site	probably null
R5913:Hectd4	UTSW	5	121323974	missense	possibly damaging	0.83
R5920:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R5943:Hectd4	UTSW	5	121322294	missense	probably benign	0.01
R6219:Hectd4	UTSW	5	121308878	missense	possibly damaging	0.92
R6250:Hectd4	UTSW	5	121339498	missense	possibly damaging	0.85
R6301:Hectd4	UTSW	5	121254220	missense	possibly damaging	0.91
R6428:Hectd4	UTSW	5	121350445	missense	possibly damaging	0.53
R6446:Hectd4	UTSW	5	121334375	missense	possibly damaging	0.86
R6453:Hectd4	UTSW	5	121350592	missense	probably damaging	1.00
R6513:Hectd4	UTSW	5	121356196	splice site	probably null
R6540:Hectd4	UTSW	5	121303571	missense	probably benign	0.33
R6706:Hectd4	UTSW	5	121320084	missense	possibly damaging	0.92
R6720:Hectd4	UTSW	5	121307381	nonsense	probably null
R6736:Hectd4	UTSW	5	121277725	missense	possibly damaging	0.86
R6776:Hectd4	UTSW	5	121353511	missense	possibly damaging	0.85
R7033:Hectd4	UTSW	5	121364568	missense	possibly damaging	0.86
R7038:Hectd4	UTSW	5	121299597	missense	possibly damaging	0.90
R7175:Hectd4	UTSW	5	121273629	missense	possibly damaging	0.85
R7180:Hectd4	UTSW	5	121308342	missense	probably benign	0.01
R7234:Hectd4	UTSW	5	121329073	missense	possibly damaging	0.53
R7253:Hectd4	UTSW	5	121314881	missense	possibly damaging	0.66
R7349:Hectd4	UTSW	5	121310663	missense	probably damaging	0.97
R7450:Hectd4	UTSW	5	121281932	missense	probably benign	0.00
R7467:Hectd4	UTSW	5	121323961	missense	possibly damaging	0.66
R7482:Hectd4	UTSW	5	121363878	missense	possibly damaging	0.71
R7512:Hectd4	UTSW	5	121297109	missense	possibly damaging	0.72
R7525:Hectd4	UTSW	5	121343665	missense	possibly damaging	0.70
R7559:Hectd4	UTSW	5	121315510	splice site	probably null
R7560:Hectd4	UTSW	5	121254342	missense	possibly damaging	0.53
R7561:Hectd4	UTSW	5	121291225	missense	possibly damaging	0.91
R7576:Hectd4	UTSW	5	121349459	missense	possibly damaging	0.91
R7584:Hectd4	UTSW	5	121318735	missense	possibly damaging	0.83
R7648:Hectd4	UTSW	5	121254371	missense	possibly damaging	0.73
R7663:Hectd4	UTSW	5	121324031	missense	probably benign	0.06
R7692:Hectd4	UTSW	5	121321564	missense	possibly damaging	0.46
R7725:Hectd4	UTSW	5	121220617	missense	unknown
R7731:Hectd4	UTSW	5	121307014	missense	probably benign	0.00
R7732:Hectd4	UTSW	5	121336629	missense	probably benign	0.14
R7782:Hectd4	UTSW	5	121305721	missense	possibly damaging	0.53
X0026:Hectd4	UTSW	5	121349637	missense	probably benign	0.04
X0027:Hectd4	UTSW	5	121321404	missense	probably benign	0.27
Z1088:Hectd4	UTSW	5	121295503	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGCAGAAGATGGTGCTGG -3'
(R):5'- CACTCACCTAGTTTGATGTGGAC -3'

Sequencing Primer
(F):5'- TCAGTTGCACACTACCATTATAGC -3'
(R):5'- GACTTTGTCTGTGGAAAGAACC -3'

Posted On

2016-06-21