Incidental Mutation 'R5129:Tlr3'
ID394906
Institutional Source Beutler Lab
Gene Symbol Tlr3
Ensembl Gene ENSMUSG00000031639
Gene Nametoll-like receptor 3
Synonyms
MMRRC Submission 042717-MU
Accession Numbers

Ncbi RefSeq: NM_126166; MGI: 2156367

Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45395665-45411080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45402981 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 54 (I54K)
Ref Sequence ENSEMBL: ENSMUSP00000148127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034056] [ENSMUST00000167106] [ENSMUST00000209651] [ENSMUST00000209772] [ENSMUST00000210013] [ENSMUST00000210996] [ENSMUST00000211370]
Predicted Effect probably damaging
Transcript: ENSMUST00000034056
AA Change: I54K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034056
Gene: ENSMUSG00000031639
AA Change: I54K

DomainStartEndE-ValueType
LRRNT 28 56 1.14e1 SMART
LRR 50 74 1.33e1 SMART
LRR_TYP 99 122 4.72e-2 SMART
LRR 123 146 2.47e2 SMART
LRR 171 194 3.36e1 SMART
LRR 198 220 7.57e0 SMART
low complexity region 224 238 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
LRR 274 297 1.06e1 SMART
LRR_TYP 298 321 1.28e-3 SMART
LRR 355 378 6.23e1 SMART
LRR 379 404 3.18e2 SMART
LRR 405 430 8.98e1 SMART
LRR 431 455 6.78e1 SMART
LRR_TYP 506 529 1.79e-2 SMART
LRR 530 553 2.63e0 SMART
LRR_TYP 562 585 1.56e-2 SMART
LRR 586 609 1.37e1 SMART
LRR 611 633 8.48e0 SMART
LRRCT 646 698 1.07e-10 SMART
transmembrane domain 705 724 N/A INTRINSIC
TIR 756 901 2.43e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167106
AA Change: I54K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126556
Gene: ENSMUSG00000031639
AA Change: I54K

DomainStartEndE-ValueType
LRRNT 28 56 1.14e1 SMART
LRR 50 74 1.33e1 SMART
LRR_TYP 99 122 4.72e-2 SMART
LRR 123 146 2.47e2 SMART
LRR 171 194 3.36e1 SMART
LRR 198 220 7.57e0 SMART
low complexity region 224 238 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
LRR 274 297 1.06e1 SMART
LRR_TYP 298 321 1.28e-3 SMART
LRR 355 378 6.23e1 SMART
LRR 379 404 3.18e2 SMART
LRR 405 430 8.98e1 SMART
LRR 431 455 6.78e1 SMART
LRR_TYP 506 529 1.79e-2 SMART
LRR 530 553 2.63e0 SMART
LRR_TYP 562 585 1.56e-2 SMART
LRR 586 609 1.37e1 SMART
LRR 611 633 8.48e0 SMART
LRRCT 646 698 1.07e-10 SMART
transmembrane domain 705 724 N/A INTRINSIC
TIR 756 901 2.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209651
Predicted Effect probably damaging
Transcript: ENSMUST00000209772
AA Change: I54K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210013
Predicted Effect probably benign
Transcript: ENSMUST00000210996
Predicted Effect probably damaging
Transcript: ENSMUST00000211370
AA Change: I54K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9412 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses. Use of alternative polyadenylation sites to generate different length transcripts has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show alterations in innate immunity against different viruses, viral pathogenesis, anxiety, hippocampal synaptic plasticity, memory retention and neurogenesis. Homozygotes for another null allele show altered ds-RNA responses in dendritic and aorta smooth muscle cells. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Tlr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tlr3 APN 8 45400690 missense probably damaging 0.99
IGL01820:Tlr3 APN 8 45398339 missense probably benign
IGL02504:Tlr3 APN 8 45397907 missense probably damaging 1.00
IGL02523:Tlr3 APN 8 45398391 unclassified probably null
IGL03166:Tlr3 APN 8 45402928 missense probably benign 0.05
IGL03287:Tlr3 APN 8 45402780 missense probably benign
Rakshasa UTSW 8 45397697 missense probably benign 0.08
Ultraman UTSW 8 45402981 missense probably damaging 1.00
E0354:Tlr3 UTSW 8 45400820 missense probably damaging 1.00
R0960:Tlr3 UTSW 8 45397415 missense probably damaging 1.00
R1175:Tlr3 UTSW 8 45397134 missense probably damaging 1.00
R1332:Tlr3 UTSW 8 45398737 missense probably damaging 0.99
R1477:Tlr3 UTSW 8 45398165 missense probably damaging 1.00
R1667:Tlr3 UTSW 8 45400837 missense probably benign 0.00
R1755:Tlr3 UTSW 8 45397973 missense probably benign
R1996:Tlr3 UTSW 8 45397697 missense probably benign 0.08
R2012:Tlr3 UTSW 8 45402786 missense possibly damaging 0.91
R2288:Tlr3 UTSW 8 45397668 missense probably damaging 0.98
R2895:Tlr3 UTSW 8 45397592 missense possibly damaging 0.89
R3837:Tlr3 UTSW 8 45396939 missense probably damaging 1.00
R4905:Tlr3 UTSW 8 45399223 critical splice acceptor site probably null
R4934:Tlr3 UTSW 8 45397035 missense probably benign 0.10
R5025:Tlr3 UTSW 8 45403038 missense probably benign 0.00
R5086:Tlr3 UTSW 8 45402825 missense probably damaging 0.96
R5320:Tlr3 UTSW 8 45399100 missense possibly damaging 0.95
R5411:Tlr3 UTSW 8 45396955 missense probably benign 0.01
R5497:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5498:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5499:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5501:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5731:Tlr3 UTSW 8 45398120 missense probably benign 0.00
R5761:Tlr3 UTSW 8 45402771 missense probably benign 0.00
R5992:Tlr3 UTSW 8 45397814 missense probably benign
R6031:Tlr3 UTSW 8 45398528 missense probably damaging 1.00
R6031:Tlr3 UTSW 8 45398528 missense probably damaging 1.00
R6104:Tlr3 UTSW 8 45403093 missense probably benign 0.00
R6289:Tlr3 UTSW 8 45396929 missense probably benign 0.04
R6372:Tlr3 UTSW 8 45397011 missense probably damaging 1.00
R6470:Tlr3 UTSW 8 45397385 missense probably damaging 1.00
R6486:Tlr3 UTSW 8 45398613 unclassified probably null
R6504:Tlr3 UTSW 8 45397449 missense possibly damaging 0.79
R6721:Tlr3 UTSW 8 45398880 missense probably benign 0.00
R7089:Tlr3 UTSW 8 45397773 missense probably benign 0.02
R7169:Tlr3 UTSW 8 45397019 missense probably damaging 1.00
R7679:Tlr3 UTSW 8 45399051 missense probably benign
R7771:Tlr3 UTSW 8 45403039 missense probably benign
R7863:Tlr3 UTSW 8 45397737 missense probably benign 0.00
R7896:Tlr3 UTSW 8 45397053 nonsense probably null
R7946:Tlr3 UTSW 8 45397737 missense probably benign 0.00
R7979:Tlr3 UTSW 8 45397053 nonsense probably null
R8009:Tlr3 UTSW 8 45400782 missense not run
Z1177:Tlr3 UTSW 8 45397983 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTAGATCGAGTTCTGTCAGG -3'
(R):5'- GCTGAATCATGAAAGGGTGTTC -3'

Sequencing Primer
(F):5'- CTGTCAGGTTCGTGCAGAAGAC -3'
(R):5'- AGGGTGTTCCTCTTATCTAATGTAC -3'
Posted On2016-06-21