Incidental Mutation 'R5129:Cdh13'
ID394908
Institutional Source Beutler Lab
Gene Symbol Cdh13
Ensembl Gene ENSMUSG00000031841
Gene Namecadherin 13
SynonymsT-cadherin, 4932416G01Rik, Tcad
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location118283733-119324921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119095215 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000113527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117160]
PDB Structure
Crystal Structure of mouse T-cadherin EC1 EC2 [X-RAY DIFFRACTION]
Crystal structure of mouse T-cadherin EC1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000117160
AA Change: D271G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113527
Gene: ENSMUSG00000031841
AA Change: D271G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Cadherin_pro 26 112 1.04e-17 SMART
CA 160 243 1.49e-18 SMART
CA 267 361 1.84e-23 SMART
CA 383 476 8.75e-16 SMART
CA 499 583 2.36e-21 SMART
CA 604 687 5.93e-2 SMART
low complexity region 695 714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148836
Meta Mutation Damage Score 0.9077 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is highly expressed in the vasculature including endothelial cells, smooth muscle cells and pericytes, where the encoded protein binds to adiponectin and has been implicated in the modulation of angiogenesis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased retinal neovascularization and increased adiponectin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Cdh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Cdh13 APN 8 119312506 missense possibly damaging 0.87
IGL00659:Cdh13 APN 8 119312667 missense probably damaging 1.00
IGL01662:Cdh13 APN 8 118675177 missense probably damaging 0.99
IGL01719:Cdh13 APN 8 118675188 missense probably benign 0.01
IGL02148:Cdh13 APN 8 119198958 missense probably damaging 1.00
IGL02157:Cdh13 APN 8 118505671 missense possibly damaging 0.68
IGL02188:Cdh13 APN 8 118851761 missense probably benign 0.08
IGL02490:Cdh13 APN 8 119095323 missense probably damaging 1.00
IGL02851:Cdh13 APN 8 118675158 missense probably benign 0.32
IGL02958:Cdh13 APN 8 119312721 missense possibly damaging 0.90
IGL03085:Cdh13 APN 8 119288724 missense probably damaging 1.00
IGL03230:Cdh13 APN 8 119242317 missense probably damaging 1.00
IGL03280:Cdh13 APN 8 119314134 missense probably damaging 1.00
K3955:Cdh13 UTSW 8 118675104 missense probably damaging 0.99
P0038:Cdh13 UTSW 8 118675104 missense probably damaging 0.99
R0398:Cdh13 UTSW 8 119314047 missense probably damaging 1.00
R2156:Cdh13 UTSW 8 119236964 missense probably damaging 1.00
R3415:Cdh13 UTSW 8 118675207 missense probably benign 0.35
R4243:Cdh13 UTSW 8 119242257 missense probably damaging 1.00
R4839:Cdh13 UTSW 8 118851848 nonsense probably null
R4851:Cdh13 UTSW 8 118757390 missense possibly damaging 0.75
R5453:Cdh13 UTSW 8 119198967 missense probably damaging 1.00
R5607:Cdh13 UTSW 8 118757474 missense probably benign
R5608:Cdh13 UTSW 8 118757474 missense probably benign
R5610:Cdh13 UTSW 8 118851723 missense possibly damaging 0.95
R6035:Cdh13 UTSW 8 118505698 missense probably benign 0.03
R6035:Cdh13 UTSW 8 118505698 missense probably benign 0.03
R6556:Cdh13 UTSW 8 118968187 missense probably damaging 0.99
R7124:Cdh13 UTSW 8 118968173 missense probably damaging 1.00
R7349:Cdh13 UTSW 8 119242358 missense probably damaging 0.97
R7418:Cdh13 UTSW 8 119312525 missense probably damaging 1.00
R7679:Cdh13 UTSW 8 119236919 missense probably benign 0.29
R7807:Cdh13 UTSW 8 118283855 start codon destroyed probably null 0.77
X0025:Cdh13 UTSW 8 118505679 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCGGGTCCTTTAATGTGATAGAGC -3'
(R):5'- GCTGTGCTCCATTCTCACAAAG -3'

Sequencing Primer
(F):5'- TCCTTTAATGTGATAGAGCAGGCAG -3'
(R):5'- GAAGAAAACAGAATCCTTTCCGCTC -3'
Posted On2016-06-21