Incidental Mutation 'R5129:Adamts14'
ID394913
Institutional Source Beutler Lab
Gene Symbol Adamts14
Ensembl Gene ENSMUSG00000059901
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14
SynonymsAdamts-14, TS14
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61197112-61273438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61249618 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 209 (D209V)
Ref Sequence ENSEMBL: ENSMUSP00000090143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092486] [ENSMUST00000120336]
Predicted Effect probably benign
Transcript: ENSMUST00000092486
AA Change: D209V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000090143
Gene: ENSMUSG00000059901
AA Change: D209V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 194 6.3e-30 PFAM
Pfam:Reprolysin_5 245 424 6e-17 PFAM
Pfam:Reprolysin_4 246 432 2.5e-7 PFAM
Pfam:Reprolysin 246 447 1.9e-21 PFAM
Pfam:Reprolysin_2 264 437 9.2e-10 PFAM
Pfam:Reprolysin_3 268 396 2.5e-12 PFAM
TSP1 542 594 5.9e-16 SMART
Pfam:ADAM_spacer1 701 816 1.8e-24 PFAM
TSP1 837 894 2.1e-2 SMART
TSP1 897 956 3.42e-3 SMART
TSP1 959 1009 4.48e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120336
AA Change: D209V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112723
Gene: ENSMUSG00000059901
AA Change: D209V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 194 1.6e-38 PFAM
Pfam:Reprolysin_5 245 427 5.9e-16 PFAM
Pfam:Reprolysin_4 246 435 1.1e-7 PFAM
Pfam:Reprolysin 246 450 3.2e-20 PFAM
Pfam:Reprolysin_2 264 441 5.5e-12 PFAM
Pfam:Reprolysin_3 268 399 1.5e-13 PFAM
TSP1 545 597 5.9e-16 SMART
Pfam:ADAM_spacer1 704 819 8e-25 PFAM
TSP1 840 897 2.1e-2 SMART
TSP1 900 959 3.42e-3 SMART
TSP1 962 1012 4.48e-7 SMART
Meta Mutation Damage Score 0.1508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme cleaves amino-terminal propeptides from type I procollagen, a necessary step in the formation of collagen fibers. Mutations in this gene may be associated with osteoarthritis in human patients. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Adamts14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Adamts14 APN 10 61229676 missense probably damaging 1.00
IGL00800:Adamts14 APN 10 61205418 missense probably benign 0.00
IGL01021:Adamts14 APN 10 61225373 missense probably damaging 0.99
IGL01022:Adamts14 APN 10 61202942 missense probably benign 0.01
IGL01335:Adamts14 APN 10 61198681 missense possibly damaging 0.90
IGL01419:Adamts14 APN 10 61205542 splice site probably benign
IGL01595:Adamts14 APN 10 61205473 missense probably damaging 1.00
R0594:Adamts14 UTSW 10 61202887 missense probably damaging 1.00
R0629:Adamts14 UTSW 10 61211624 nonsense probably null
R1459:Adamts14 UTSW 10 61198804 missense probably benign 0.13
R1565:Adamts14 UTSW 10 61270897 missense probably damaging 1.00
R1686:Adamts14 UTSW 10 61198660 missense probably benign
R1792:Adamts14 UTSW 10 61218498 missense probably benign 0.07
R1876:Adamts14 UTSW 10 61200372 missense probably benign 0.03
R1992:Adamts14 UTSW 10 61198660 missense probably benign
R2064:Adamts14 UTSW 10 61205522 missense probably benign 0.24
R2495:Adamts14 UTSW 10 61198970 splice site probably null
R2848:Adamts14 UTSW 10 61218435 missense probably damaging 1.00
R2897:Adamts14 UTSW 10 61204910 missense probably damaging 0.99
R3428:Adamts14 UTSW 10 61224374 missense probably benign 0.36
R4006:Adamts14 UTSW 10 61202821 critical splice donor site probably null
R5327:Adamts14 UTSW 10 61198488 missense probably benign 0.01
R5524:Adamts14 UTSW 10 61230443 missense probably damaging 1.00
R5594:Adamts14 UTSW 10 61227101 splice site probably null
R5694:Adamts14 UTSW 10 61229652 missense probably benign 0.45
R5801:Adamts14 UTSW 10 61202996 missense probably damaging 0.99
R5941:Adamts14 UTSW 10 61221895 missense probably damaging 1.00
R5953:Adamts14 UTSW 10 61207446 missense probably damaging 0.99
R6778:Adamts14 UTSW 10 61225452 missense probably damaging 1.00
R7169:Adamts14 UTSW 10 61204928 missense probably damaging 0.97
R7215:Adamts14 UTSW 10 61211596 missense possibly damaging 0.89
R7337:Adamts14 UTSW 10 61207460 missense probably damaging 0.98
R7511:Adamts14 UTSW 10 61218528 missense possibly damaging 0.74
R7640:Adamts14 UTSW 10 61246057 missense probably benign 0.00
R7798:Adamts14 UTSW 10 61271173 missense probably damaging 0.99
R7902:Adamts14 UTSW 10 61205397 missense possibly damaging 0.92
R7985:Adamts14 UTSW 10 61205397 missense possibly damaging 0.92
R8062:Adamts14 UTSW 10 61200361 critical splice donor site probably null
R8284:Adamts14 UTSW 10 61198659 missense possibly damaging 0.55
R8319:Adamts14 UTSW 10 61221927 missense probably benign
Z1088:Adamts14 UTSW 10 61218445 missense probably damaging 1.00
Z1177:Adamts14 UTSW 10 61198843 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CCGTGTTCAAGACCCAAGTG -3'
(R):5'- CTGGAGGAAGAGTCTACACACG -3'

Sequencing Primer
(F):5'- GTGTTCAAGACCCAAGTGACTTTC -3'
(R):5'- GAAGAGTCTACACACGTGTTTG -3'
Posted On2016-06-21