Incidental Mutation 'R5129:G3bp1'
ID394916
Institutional Source Beutler Lab
Gene Symbol G3bp1
Ensembl Gene ENSMUSG00000018583
Gene NameGTPase activating protein (SH3 domain) binding protein 1
SynonymsGAP SH3 binding protein
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location55469685-55504838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55489116 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000018727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018727]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018727
AA Change: V92A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018727
Gene: ENSMUSG00000018583
AA Change: V92A

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.8e-35 PFAM
low complexity region 142 167 N/A INTRINSIC
low complexity region 187 206 N/A INTRINSIC
low complexity region 211 225 N/A INTRINSIC
low complexity region 289 305 N/A INTRINSIC
RRM 339 409 1.49e-13 SMART
low complexity region 419 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151790
Meta Mutation Damage Score 0.2754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display perinatal lethality with severe cell death in the nervous system and decreased cell proliferation. Neonates from heterozygous null female mice display increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in G3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02231:G3bp1 APN 11 55495447 nonsense probably null
silverheels UTSW 11 55489116 missense possibly damaging 0.95
R0056:G3bp1 UTSW 11 55498041 missense probably benign 0.03
R0113:G3bp1 UTSW 11 55495426 missense probably benign 0.00
R0240:G3bp1 UTSW 11 55492028 missense probably damaging 1.00
R0240:G3bp1 UTSW 11 55492028 missense probably damaging 1.00
R0311:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0312:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0367:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0368:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0454:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0464:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0465:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0466:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0467:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0486:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0487:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0533:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0551:G3bp1 UTSW 11 55489143 missense probably benign 0.01
R0689:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0848:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R2109:G3bp1 UTSW 11 55489160 missense probably damaging 0.97
R5439:G3bp1 UTSW 11 55497987 missense probably damaging 0.96
R5834:G3bp1 UTSW 11 55497940 missense probably benign
R6692:G3bp1 UTSW 11 55493509 missense probably benign 0.00
R6925:G3bp1 UTSW 11 55497960 missense possibly damaging 0.47
R7091:G3bp1 UTSW 11 55496221 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GAGGATCTGCCAGTCTGTTC -3'
(R):5'- GCACCACAGCTTTAGGACAAG -3'

Sequencing Primer
(F):5'- CTGTTCTTGGTGCTGGCAAC -3'
(R):5'- GACAGAGCAGCTCTACCCTG -3'
Posted On2016-06-21