Incidental Mutation 'R5129:Zfp457'
ID394919
Institutional Source Beutler Lab
Gene Symbol Zfp457
Ensembl Gene ENSMUSG00000055341
Gene Namezinc finger protein 457
SynonymsRslcan-6
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67288138-67306485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67293356 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 385 (E385G)
Ref Sequence ENSEMBL: ENSMUSP00000053879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049705] [ENSMUST00000224325]
Predicted Effect probably benign
Transcript: ENSMUST00000049705
AA Change: E385G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000053879
Gene: ENSMUSG00000055341
AA Change: E385G

DomainStartEndE-ValueType
KRAB 5 65 1.55e-29 SMART
ZnF_C2H2 81 103 2.75e-3 SMART
ZnF_C2H2 109 131 1.1e-2 SMART
ZnF_C2H2 165 187 3.63e-3 SMART
ZnF_C2H2 193 215 2.4e-3 SMART
ZnF_C2H2 221 243 1.12e-3 SMART
ZnF_C2H2 249 271 6.32e-3 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 3.89e-3 SMART
ZnF_C2H2 361 383 7.26e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 7.67e-2 SMART
ZnF_C2H2 445 467 1.05e1 SMART
ZnF_C2H2 473 495 3.11e-2 SMART
ZnF_C2H2 501 523 5.9e-3 SMART
ZnF_C2H2 529 551 9.08e-4 SMART
ZnF_C2H2 585 607 5.72e-1 SMART
transmembrane domain 624 646 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224325
AA Change: E289G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225090
Predicted Effect probably benign
Transcript: ENSMUST00000225338
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Zfp457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Zfp457 APN 13 67294266 missense possibly damaging 0.46
IGL02259:Zfp457 APN 13 67296407 missense possibly damaging 0.88
R0055:Zfp457 UTSW 13 67294034 missense probably damaging 0.99
R0055:Zfp457 UTSW 13 67294034 missense probably damaging 0.99
R0149:Zfp457 UTSW 13 67292646 missense probably damaging 0.97
R0211:Zfp457 UTSW 13 67293147 missense probably benign 0.01
R0211:Zfp457 UTSW 13 67293147 missense probably benign 0.01
R0230:Zfp457 UTSW 13 67294116 missense possibly damaging 0.91
R0270:Zfp457 UTSW 13 67293927 missense probably damaging 1.00
R0361:Zfp457 UTSW 13 67292646 missense probably damaging 0.97
R0561:Zfp457 UTSW 13 67294070 missense probably damaging 1.00
R0679:Zfp457 UTSW 13 67293591 missense probably damaging 1.00
R0826:Zfp457 UTSW 13 67293314 missense possibly damaging 0.85
R1136:Zfp457 UTSW 13 67293782 missense probably damaging 1.00
R1175:Zfp457 UTSW 13 67293684 missense probably damaging 1.00
R1523:Zfp457 UTSW 13 67293437 missense probably damaging 1.00
R1616:Zfp457 UTSW 13 67296311 missense possibly damaging 0.95
R2348:Zfp457 UTSW 13 67293404 missense probably benign 0.33
R4930:Zfp457 UTSW 13 67294100 missense probably damaging 1.00
R4964:Zfp457 UTSW 13 67293278 missense probably damaging 1.00
R4966:Zfp457 UTSW 13 67293278 missense probably damaging 1.00
R5040:Zfp457 UTSW 13 67292835 missense probably benign 0.03
R5714:Zfp457 UTSW 13 67296426 missense possibly damaging 0.85
R6017:Zfp457 UTSW 13 67293699 missense probably damaging 1.00
R6052:Zfp457 UTSW 13 67293951 missense probably damaging 1.00
R6132:Zfp457 UTSW 13 67293296 nonsense probably null
R6184:Zfp457 UTSW 13 67292912 missense possibly damaging 0.89
R6313:Zfp457 UTSW 13 67292682 missense probably damaging 1.00
R7038:Zfp457 UTSW 13 67293933 missense probably benign 0.00
R7170:Zfp457 UTSW 13 67294177 nonsense probably null
R7184:Zfp457 UTSW 13 67294001 missense possibly damaging 0.69
R7859:Zfp457 UTSW 13 67306381 start gained probably benign
R7973:Zfp457 UTSW 13 67293818 missense probably benign 0.20
R8308:Zfp457 UTSW 13 67293599 missense probably benign 0.00
R8346:Zfp457 UTSW 13 67293798 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTCACACTTGTAGGGTTTCTCTC -3'
(R):5'- CAAATGTGAAGTTTGTGGCAAG -3'

Sequencing Primer
(F):5'- GCCACATATGTCACACTTGTAGGG -3'
(R):5'- AAGTTTGTGGCAAGACCTTCC -3'
Posted On2016-06-21