Incidental Mutation 'R5129:Capn7'
ID394922
Institutional Source Beutler Lab
Gene Symbol Capn7
Ensembl Gene ENSMUSG00000021893
Gene Namecalpain 7
SynonymsPalBH
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31336638-31371986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31344511 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 94 (V94A)
Ref Sequence ENSEMBL: ENSMUSP00000119214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022451] [ENSMUST00000143472] [ENSMUST00000152182]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022451
AA Change: V94A

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022451
Gene: ENSMUSG00000021893
AA Change: V94A

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 547 1.08e-91 SMART
Blast:CysPc 550 620 4e-39 BLAST
calpain_III 686 810 2.78e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143472
AA Change: V94A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118596
Gene: ENSMUSG00000021893
AA Change: V94A

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152182
AA Change: V94A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119214
Gene: ENSMUSG00000021893
AA Change: V94A

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Meta Mutation Damage Score 0.1530 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene frequently die before weaning. Survivors display reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Capn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Capn7 APN 14 31363578 missense probably benign 0.41
IGL01481:Capn7 APN 14 31355339 missense probably damaging 1.00
IGL03231:Capn7 APN 14 31355290 missense probably damaging 1.00
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0077:Capn7 UTSW 14 31368115 missense probably benign 0.10
R0195:Capn7 UTSW 14 31365581 missense probably damaging 1.00
R0316:Capn7 UTSW 14 31347809 missense probably benign 0.00
R0815:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R0863:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R1697:Capn7 UTSW 14 31360160 missense probably damaging 1.00
R1954:Capn7 UTSW 14 31360150 missense probably damaging 1.00
R2096:Capn7 UTSW 14 31349887 critical splice donor site probably null
R3121:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R3122:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R4409:Capn7 UTSW 14 31355339 missense probably damaging 1.00
R4676:Capn7 UTSW 14 31359259 missense possibly damaging 0.72
R4799:Capn7 UTSW 14 31360557 missense probably benign 0.01
R5023:Capn7 UTSW 14 31352426 missense probably damaging 0.99
R5460:Capn7 UTSW 14 31368203 critical splice donor site probably null
R5608:Capn7 UTSW 14 31370707 missense probably damaging 1.00
R5665:Capn7 UTSW 14 31369802 missense probably benign 0.00
R5786:Capn7 UTSW 14 31360145 missense probably damaging 1.00
R6186:Capn7 UTSW 14 31370918 missense probably damaging 1.00
R6190:Capn7 UTSW 14 31363603 missense probably benign 0.10
R6411:Capn7 UTSW 14 31340096 missense probably benign 0.00
R6514:Capn7 UTSW 14 31344554 missense probably benign 0.00
R6838:Capn7 UTSW 14 31354173 missense possibly damaging 0.95
R7041:Capn7 UTSW 14 31336685 unclassified probably benign
R7047:Capn7 UTSW 14 31336685 unclassified probably benign
R7124:Capn7 UTSW 14 31336685 unclassified probably benign
R7224:Capn7 UTSW 14 31370721 nonsense probably null
R7417:Capn7 UTSW 14 31370706 missense probably damaging 1.00
R7419:Capn7 UTSW 14 31349822 missense probably benign 0.02
R7544:Capn7 UTSW 14 31340050 missense probably damaging 1.00
R7699:Capn7 UTSW 14 31352444 missense probably benign 0.00
R7700:Capn7 UTSW 14 31352444 missense probably benign 0.00
R7775:Capn7 UTSW 14 31352410 missense probably benign 0.00
R7824:Capn7 UTSW 14 31352410 missense probably benign 0.00
R7908:Capn7 UTSW 14 31366245 critical splice donor site probably null
R8057:Capn7 UTSW 14 31370979 missense probably benign 0.27
R8176:Capn7 UTSW 14 31347772 missense probably benign 0.03
R8270:Capn7 UTSW 14 31358679 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCTGATGTCTAAATAATTGGGTTTGG -3'
(R):5'- TGATAGAATGGCAGGGCTCC -3'

Sequencing Primer
(F):5'- CTAAATAATTGGGTTTGGGCAGG -3'
(R):5'- GGGCTCCTTCCAAATAAATAAATCTG -3'
Posted On2016-06-21