Incidental Mutation 'R5129:Krt78'
ID394925
Institutional Source Beutler Lab
Gene Symbol Krt78
Ensembl Gene ENSMUSG00000050463
Gene Namekeratin 78
Synonyms2310030B04Rik
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101946001-101954287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101947580 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 599 (V599L)
Ref Sequence ENSEMBL: ENSMUSP00000126197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164932]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164932
AA Change: V599L

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126197
Gene: ENSMUSG00000050463
AA Change: V599L

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 101 5.7e-16 PFAM
Filament 104 417 1.38e-133 SMART
internal_repeat_1 421 660 8.87e-74 PROSPERO
internal_repeat_1 704 957 8.87e-74 PROSPERO
low complexity region 1033 1049 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin gene family and encodes a protein with an intermediate filament domain. Keratins are the major structural proteins in epithelial cells, forming a cytoplasmic network of 10 to 12 nm wide intermediate filaments and creating a scaffold that gives cells the ability to withstand mechanical and non-mechanical stresses. The genes of the type II keratin family are located as a gene cluster at 12p13.13. Four pseudogenes of this gene family have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Krt78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt78 APN 15 101947510 missense probably benign 0.28
IGL01358:Krt78 APN 15 101946263 missense probably benign 0.18
IGL01723:Krt78 APN 15 101951798 missense possibly damaging 0.65
IGL01743:Krt78 APN 15 101950898 missense probably benign 0.06
IGL01778:Krt78 APN 15 101950967 missense probably damaging 1.00
IGL01792:Krt78 APN 15 101946650 missense probably benign 0.01
IGL02271:Krt78 APN 15 101948593 missense probably benign 0.02
IGL02481:Krt78 APN 15 101948418 splice site probably benign
IGL02494:Krt78 APN 15 101954051 missense probably benign 0.00
IGL02708:Krt78 APN 15 101953407 missense possibly damaging 0.88
IGL02747:Krt78 APN 15 101950384 splice site probably benign
IGL02997:Krt78 APN 15 101947163 missense probably benign 0.11
IGL03350:Krt78 APN 15 101946517 missense probably benign 0.02
IGL03410:Krt78 APN 15 101953986 missense probably damaging 0.99
PIT4812001:Krt78 UTSW 15 101948069 missense probably damaging 1.00
R0090:Krt78 UTSW 15 101947837 missense probably benign 0.35
R0513:Krt78 UTSW 15 101950949 missense probably damaging 1.00
R0908:Krt78 UTSW 15 101950901 missense probably damaging 1.00
R1067:Krt78 UTSW 15 101946461 nonsense probably null
R1070:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1194:Krt78 UTSW 15 101951786 missense probably damaging 0.99
R1213:Krt78 UTSW 15 101951810 missense probably benign 0.10
R1467:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1467:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1612:Krt78 UTSW 15 101951844 splice site probably null
R1750:Krt78 UTSW 15 101946377 missense probably benign 0.33
R1796:Krt78 UTSW 15 101950865 missense probably damaging 1.00
R1863:Krt78 UTSW 15 101946569 missense possibly damaging 0.53
R1901:Krt78 UTSW 15 101946963 nonsense probably null
R1902:Krt78 UTSW 15 101946963 nonsense probably null
R1975:Krt78 UTSW 15 101946168 makesense probably null
R2105:Krt78 UTSW 15 101947414 missense possibly damaging 0.93
R2418:Krt78 UTSW 15 101946634 missense probably benign
R2421:Krt78 UTSW 15 101947264 missense probably damaging 0.96
R2422:Krt78 UTSW 15 101947264 missense probably damaging 0.96
R2443:Krt78 UTSW 15 101946598 missense probably damaging 1.00
R2897:Krt78 UTSW 15 101947106 missense probably benign
R4422:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4424:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4425:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4583:Krt78 UTSW 15 101946620 missense possibly damaging 0.53
R4752:Krt78 UTSW 15 101948202 missense probably benign 0.05
R4927:Krt78 UTSW 15 101946899 missense probably benign 0.02
R5391:Krt78 UTSW 15 101951828 nonsense probably null
R5575:Krt78 UTSW 15 101947352 nonsense probably null
R5617:Krt78 UTSW 15 101947609 missense probably damaging 0.99
R5806:Krt78 UTSW 15 101950502 missense probably damaging 1.00
R5906:Krt78 UTSW 15 101948595 missense probably damaging 0.98
R5993:Krt78 UTSW 15 101950449 missense probably damaging 1.00
R6520:Krt78 UTSW 15 101951771 missense probably benign 0.26
R6531:Krt78 UTSW 15 101952273 missense probably benign 0.03
R6587:Krt78 UTSW 15 101952269 missense probably benign 0.10
R6749:Krt78 UTSW 15 101950923 missense probably damaging 1.00
R7126:Krt78 UTSW 15 101948436 missense probably damaging 1.00
R7158:Krt78 UTSW 15 101951806 missense probably benign 0.17
R7229:Krt78 UTSW 15 101947394 missense probably benign 0.01
R7523:Krt78 UTSW 15 101946601 missense not run
R7638:Krt78 UTSW 15 101950883 missense probably damaging 1.00
X0018:Krt78 UTSW 15 101951800 missense possibly damaging 0.96
Z1088:Krt78 UTSW 15 101947331 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCATATTCTCTTCCAGGCACGG -3'
(R):5'- TCCTGGAAGAGGATCTGGAG -3'

Sequencing Primer
(F):5'- TCTTCCAGGCACGGTCACC -3'
(R):5'- TCTGGAGGCCAAGTGACTG -3'
Posted On2016-06-21