Incidental Mutation 'R5129:Dvl3'
ID394927
Institutional Source Beutler Lab
Gene Symbol Dvl3
Ensembl Gene ENSMUSG00000003233
Gene Namedishevelled segment polarity protein 3
Synonyms
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20516982-20534010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20517340 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 49 (M49K)
Ref Sequence ENSEMBL: ENSMUSP00000126082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003318] [ENSMUST00000171572] [ENSMUST00000171774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003318
AA Change: M49K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003318
Gene: ENSMUSG00000003233
AA Change: M49K

DomainStartEndE-ValueType
DAX 1 82 3.17e-54 SMART
Pfam:Dishevelled 142 213 1.6e-36 PFAM
PDZ 258 337 2.92e-16 SMART
low complexity region 378 396 N/A INTRINSIC
DEP 422 496 3.43e-27 SMART
Pfam:Dsh_C 500 706 5.8e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169552
Predicted Effect possibly damaging
Transcript: ENSMUST00000171572
AA Change: M49K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130925
Gene: ENSMUSG00000003233
AA Change: M49K

DomainStartEndE-ValueType
DAX 1 82 3.17e-54 SMART
Pfam:Dishevelled 89 245 1.3e-63 PFAM
PDZ 258 337 2.92e-16 SMART
low complexity region 378 396 N/A INTRINSIC
DEP 422 496 3.43e-27 SMART
Pfam:Dsh_C 500 706 1.2e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171774
AA Change: M49K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126082
Gene: ENSMUSG00000003233
AA Change: M49K

DomainStartEndE-ValueType
DAX 1 82 3.17e-54 SMART
Pfam:Dishevelled 142 213 3.9e-37 PFAM
PDZ 258 337 2.92e-16 SMART
low complexity region 361 379 N/A INTRINSIC
DEP 405 479 3.43e-27 SMART
Pfam:Dsh_C 483 689 1.8e-88 PFAM
Meta Mutation Damage Score 0.5543 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a multi-gene family which shares strong similarity with the Drosophila dishevelled gene, dsh. The Drosophila dishevelled gene encodes a cytoplasmic phosphoprotein that regulates cell proliferation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with respiratory distress, persistent truncus arteriosis, and double outlet right ventricle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Dvl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Dvl3 APN 16 20530939 missense probably damaging 0.97
IGL02318:Dvl3 APN 16 20523743 missense possibly damaging 0.52
R0490:Dvl3 UTSW 16 20527423 splice site probably benign
R0491:Dvl3 UTSW 16 20527423 splice site probably benign
R1356:Dvl3 UTSW 16 20524305 small deletion probably benign
R1502:Dvl3 UTSW 16 20523459 missense probably damaging 0.99
R2062:Dvl3 UTSW 16 20526351 missense probably benign 0.33
R2197:Dvl3 UTSW 16 20523756 missense probably damaging 0.99
R4232:Dvl3 UTSW 16 20524233 intron probably benign
R4346:Dvl3 UTSW 16 20531299 missense possibly damaging 0.95
R4347:Dvl3 UTSW 16 20531299 missense possibly damaging 0.95
R4350:Dvl3 UTSW 16 20525644 missense possibly damaging 0.93
R4351:Dvl3 UTSW 16 20525644 missense possibly damaging 0.93
R4352:Dvl3 UTSW 16 20525644 missense possibly damaging 0.93
R5134:Dvl3 UTSW 16 20524607 intron probably benign
R5430:Dvl3 UTSW 16 20523731 missense probably damaging 1.00
R5586:Dvl3 UTSW 16 20517289 missense probably damaging 0.98
R5643:Dvl3 UTSW 16 20526276 missense probably damaging 0.99
R5644:Dvl3 UTSW 16 20526276 missense probably damaging 0.99
R5961:Dvl3 UTSW 16 20530979 missense possibly damaging 0.86
R6143:Dvl3 UTSW 16 20527039 missense possibly damaging 0.92
R6502:Dvl3 UTSW 16 20527383 missense probably damaging 1.00
R7117:Dvl3 UTSW 16 20527322 nonsense probably null
R7740:Dvl3 UTSW 16 20527250 critical splice acceptor site probably null
X0062:Dvl3 UTSW 16 20523495 missense probably damaging 1.00
Z1176:Dvl3 UTSW 16 20530881 missense probably damaging 0.97
Z1177:Dvl3 UTSW 16 20517088 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCAGTCGGTGACACTTC -3'
(R):5'- TCAAAGTCAAGTGTGTCCCAAG -3'

Sequencing Primer
(F):5'- AAGAGTCGCGATCGCCAG -3'
(R):5'- GTCAAGTGTGTCCCAAGTCACC -3'
Posted On2016-06-21