Incidental Mutation 'R5129:Prrc2a'
ID394929
Institutional Source Beutler Lab
Gene Symbol Prrc2a
Ensembl Gene ENSMUSG00000024393
Gene Nameproline-rich coiled-coil 2A
SynonymsD17H6S51E, G2, 3110039B05Rik, Bat-2, Bat2, Wbp12
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35149076-35164897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35160178 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 276 (E276G)
Ref Sequence ENSEMBL: ENSMUSP00000133550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025253] [ENSMUST00000174805]
Predicted Effect unknown
Transcript: ENSMUST00000025253
AA Change: E331G
SMART Domains Protein: ENSMUSP00000025253
Gene: ENSMUSG00000024393
AA Change: E331G

DomainStartEndE-ValueType
Pfam:BAT2_N 1 189 1.2e-70 PFAM
low complexity region 243 276 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
low complexity region 396 413 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
coiled coil region 455 494 N/A INTRINSIC
low complexity region 504 523 N/A INTRINSIC
low complexity region 527 566 N/A INTRINSIC
low complexity region 593 618 N/A INTRINSIC
low complexity region 643 684 N/A INTRINSIC
low complexity region 687 709 N/A INTRINSIC
low complexity region 711 717 N/A INTRINSIC
low complexity region 755 768 N/A INTRINSIC
low complexity region 826 833 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
low complexity region 882 894 N/A INTRINSIC
low complexity region 902 924 N/A INTRINSIC
low complexity region 944 966 N/A INTRINSIC
low complexity region 1032 1070 N/A INTRINSIC
low complexity region 1129 1149 N/A INTRINSIC
low complexity region 1162 1179 N/A INTRINSIC
low complexity region 1190 1211 N/A INTRINSIC
low complexity region 1234 1242 N/A INTRINSIC
low complexity region 1285 1300 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1394 1424 N/A INTRINSIC
low complexity region 1430 1456 N/A INTRINSIC
low complexity region 1488 1511 N/A INTRINSIC
low complexity region 1553 1565 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
internal_repeat_1 1810 1860 5.56e-5 PROSPERO
low complexity region 1879 1895 N/A INTRINSIC
internal_repeat_1 1924 1983 5.56e-5 PROSPERO
low complexity region 1995 2017 N/A INTRINSIC
low complexity region 2019 2041 N/A INTRINSIC
low complexity region 2070 2086 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172929
Predicted Effect unknown
Transcript: ENSMUST00000174805
AA Change: E276G
SMART Domains Protein: ENSMUSP00000133550
Gene: ENSMUSG00000024393
AA Change: E276G

DomainStartEndE-ValueType
Pfam:BAT2_N 1 137 6.6e-53 PFAM
low complexity region 188 221 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
coiled coil region 400 439 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 472 511 N/A INTRINSIC
low complexity region 538 563 N/A INTRINSIC
low complexity region 588 629 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 656 662 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
low complexity region 771 778 N/A INTRINSIC
low complexity region 806 816 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 847 869 N/A INTRINSIC
low complexity region 889 911 N/A INTRINSIC
low complexity region 977 1015 N/A INTRINSIC
low complexity region 1074 1094 N/A INTRINSIC
low complexity region 1107 1124 N/A INTRINSIC
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1179 1187 N/A INTRINSIC
low complexity region 1230 1245 N/A INTRINSIC
low complexity region 1291 1305 N/A INTRINSIC
low complexity region 1339 1369 N/A INTRINSIC
low complexity region 1375 1401 N/A INTRINSIC
low complexity region 1433 1456 N/A INTRINSIC
low complexity region 1498 1510 N/A INTRINSIC
low complexity region 1638 1658 N/A INTRINSIC
internal_repeat_1 1755 1804 3.99e-5 PROSPERO
low complexity region 1823 1839 N/A INTRINSIC
internal_repeat_1 1868 1927 3.99e-5 PROSPERO
low complexity region 1939 1961 N/A INTRINSIC
low complexity region 1963 1985 N/A INTRINSIC
low complexity region 2014 2030 N/A INTRINSIC
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for TNF alpha and TNF beta. These genes are all within the human major histocompatibility complex class III region. This gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. This gene is also a candidate gene for the development of rheumatoid arthritis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Prrc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Prrc2a APN 17 35154983 missense probably damaging 0.99
IGL01083:Prrc2a APN 17 35156201 missense possibly damaging 0.93
IGL01394:Prrc2a APN 17 35153104 missense probably benign 0.00
IGL01618:Prrc2a APN 17 35149553 missense probably damaging 1.00
IGL01700:Prrc2a APN 17 35150667 missense possibly damaging 0.93
IGL01937:Prrc2a APN 17 35155591 missense possibly damaging 0.63
IGL02407:Prrc2a APN 17 35160504 missense unknown
IGL02683:Prrc2a APN 17 35155993 missense probably benign 0.00
R0145:Prrc2a UTSW 17 35155820 missense probably benign
R0309:Prrc2a UTSW 17 35150915 splice site probably benign
R0441:Prrc2a UTSW 17 35149688 splice site probably benign
R0617:Prrc2a UTSW 17 35153560 missense probably damaging 1.00
R0645:Prrc2a UTSW 17 35156332 missense probably damaging 0.99
R1351:Prrc2a UTSW 17 35157887 missense possibly damaging 0.86
R1432:Prrc2a UTSW 17 35153912 splice site probably benign
R1490:Prrc2a UTSW 17 35153254 missense probably benign
R1643:Prrc2a UTSW 17 35156954 missense probably damaging 0.99
R1734:Prrc2a UTSW 17 35150707 missense possibly damaging 0.93
R1869:Prrc2a UTSW 17 35153308 missense possibly damaging 0.93
R1937:Prrc2a UTSW 17 35157908 missense probably damaging 0.99
R1995:Prrc2a UTSW 17 35157429 missense probably damaging 0.98
R2257:Prrc2a UTSW 17 35161068 missense unknown
R2270:Prrc2a UTSW 17 35149536 missense possibly damaging 0.91
R3940:Prrc2a UTSW 17 35157498 missense possibly damaging 0.86
R3973:Prrc2a UTSW 17 35157932 missense probably damaging 0.99
R4569:Prrc2a UTSW 17 35158497 missense unknown
R4655:Prrc2a UTSW 17 35155614 missense probably benign 0.00
R4792:Prrc2a UTSW 17 35156487 missense probably damaging 0.96
R4797:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R4798:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R4799:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R5004:Prrc2a UTSW 17 35149998 missense probably benign 0.11
R5155:Prrc2a UTSW 17 35160091 splice site probably null
R5210:Prrc2a UTSW 17 35153620 missense probably damaging 0.99
R5308:Prrc2a UTSW 17 35161047 missense unknown
R5474:Prrc2a UTSW 17 35159213 missense unknown
R5775:Prrc2a UTSW 17 35158487 missense unknown
R5934:Prrc2a UTSW 17 35150084 missense probably damaging 0.98
R6057:Prrc2a UTSW 17 35152740 missense probably benign 0.00
R6291:Prrc2a UTSW 17 35154933 missense probably damaging 0.99
R6535:Prrc2a UTSW 17 35162265 missense unknown
R6622:Prrc2a UTSW 17 35155420 missense probably damaging 0.98
R6887:Prrc2a UTSW 17 35155675 missense probably damaging 0.99
R6971:Prrc2a UTSW 17 35159501 intron probably null
R7026:Prrc2a UTSW 17 35161827 missense unknown
R7059:Prrc2a UTSW 17 35157388 missense probably damaging 0.99
R7489:Prrc2a UTSW 17 35162354 missense unknown
R7502:Prrc2a UTSW 17 35162310 missense unknown
R8061:Prrc2a UTSW 17 35161186 splice site probably benign
X0011:Prrc2a UTSW 17 35155898 missense probably damaging 0.99
Z1177:Prrc2a UTSW 17 35154815 missense probably damaging 0.98
Z1177:Prrc2a UTSW 17 35155700 missense probably damaging 0.99
Z1177:Prrc2a UTSW 17 35161360 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCATTCTCTGTCCAGGCTG -3'
(R):5'- CTGCCAAGTACTGAGGAGTGAG -3'

Sequencing Primer
(F):5'- GCAGATCACAGTGTAACTAAGCTCTG -3'
(R):5'- TGAGGACGTCAGGACATGTG -3'
Posted On2016-06-21