Incidental Mutation 'R5129:Olfr113'
ID394931
Institutional Source Beutler Lab
Gene Symbol Olfr113
Ensembl Gene ENSMUSG00000092292
Gene Nameolfactory receptor 113
SynonymsGA_x6K02T2PSCP-2034880-2033942, MOR218-9
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37573877-37577663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37575180 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 81 (Y81C)
Ref Sequence ENSEMBL: ENSMUSP00000149739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174139] [ENSMUST00000216181]
Predicted Effect probably damaging
Transcript: ENSMUST00000174139
AA Change: Y81C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134080
Gene: ENSMUSG00000109212
AA Change: Y81C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.7e-46 PFAM
Pfam:7TM_GPCR_Srx 32 307 3.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.2e-6 PFAM
Pfam:7tm_1 41 290 2.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191731
AA Change: Y81C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201362
AA Change: Y81C
Predicted Effect probably damaging
Transcript: ENSMUST00000216181
AA Change: Y81C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Olfr113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr113 APN 17 37574917 missense probably damaging 0.98
IGL01061:Olfr113 APN 17 37574904 missense possibly damaging 0.47
IGL01293:Olfr113 APN 17 37575417 missense probably benign
IGL01370:Olfr113 APN 17 37574521 splice site probably null
IGL01535:Olfr113 APN 17 37574788 missense possibly damaging 0.90
IGL02134:Olfr113 APN 17 37575358 missense probably benign 0.01
IGL02536:Olfr113 APN 17 37574926 missense probably damaging 1.00
IGL02640:Olfr113 APN 17 37575021 missense possibly damaging 0.73
IGL02652:Olfr113 APN 17 37574945 nonsense probably null
IGL02963:Olfr113 APN 17 37574854 missense probably benign 0.09
R0104:Olfr113 UTSW 17 37574926 missense probably damaging 1.00
R1662:Olfr113 UTSW 17 37575273 missense probably damaging 1.00
R2904:Olfr113 UTSW 17 37574814 missense possibly damaging 0.95
R5197:Olfr113 UTSW 17 37575220 missense probably benign 0.00
R5347:Olfr113 UTSW 17 37574727 missense probably damaging 0.97
R6044:Olfr113 UTSW 17 37574535 missense probably damaging 0.96
R7048:Olfr113 UTSW 17 37575223 missense probably damaging 1.00
R7064:Olfr113 UTSW 17 37574743 missense probably damaging 1.00
R8123:Olfr113 UTSW 17 37574762 missense probably benign 0.05
R8205:Olfr113 UTSW 17 37575001 missense probably damaging 1.00
R8710:Olfr113 UTSW 17 37574649 missense probably benign 0.00
X0062:Olfr113 UTSW 17 37574497 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTGGAATGACACTGCTTAG -3'
(R):5'- GCAGATCTTACAGGCTTTGCTC -3'

Sequencing Primer
(F):5'- TACACTTGCTGGGACCCATGATG -3'
(R):5'- GGCTTTGCTCTTCTTGGTGACATAC -3'
Posted On2016-06-21