Incidental Mutation 'R5129:Aldh3b1'
ID394932
Institutional Source Beutler Lab
Gene Symbol Aldh3b1
Ensembl Gene ENSMUSG00000024885
Gene Namealdehyde dehydrogenase 3 family, member B1
Synonyms1700001N19Rik, ALDH7, ALDH4
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5129 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3913493-3929761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3915336 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 392 (F392L)
Ref Sequence ENSEMBL: ENSMUSP00000056276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051803] [ENSMUST00000075092]
Predicted Effect probably benign
Transcript: ENSMUST00000051803
AA Change: F392L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000056276
Gene: ENSMUSG00000024885
AA Change: F392L

DomainStartEndE-ValueType
Pfam:Aldedh 2 428 7.4e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075092
SMART Domains Protein: ENSMUSP00000074600
Gene: ENSMUSG00000059734

DomainStartEndE-ValueType
Pfam:Fer4_10 108 163 2.4e-9 PFAM
Pfam:Fer4 109 129 1.1e-6 PFAM
Pfam:Fer4_4 110 126 2e-5 PFAM
Pfam:Fer4_7 112 166 1e-13 PFAM
Pfam:Fer4_9 112 167 8.8e-10 PFAM
Pfam:Fer4 145 168 5.3e-10 PFAM
Pfam:Fer4_4 149 173 3.1e-3 PFAM
low complexity region 181 193 N/A INTRINSIC
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase protein family. Aldehyde dehydrogenases are a family of isozymes that may play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The encoded protein is able to oxidize long-chain fatty aldehydes in vitro, and may play a role in protection from oxidative stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Uty T C Y: 1,158,592 T484A probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Aldh3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Aldh3b1 APN 19 3918104 missense probably benign 0.03
IGL01402:Aldh3b1 APN 19 3921205 missense probably benign 0.01
IGL01404:Aldh3b1 APN 19 3921205 missense probably benign 0.01
IGL01784:Aldh3b1 APN 19 3921217 missense probably benign 0.32
IGL02608:Aldh3b1 APN 19 3914061 missense probably damaging 1.00
IGL03223:Aldh3b1 APN 19 3915329 missense probably damaging 0.98
R0320:Aldh3b1 UTSW 19 3918999 splice site probably benign
R0472:Aldh3b1 UTSW 19 3914024 missense probably damaging 1.00
R0609:Aldh3b1 UTSW 19 3914024 missense probably damaging 1.00
R1272:Aldh3b1 UTSW 19 3921746 missense probably damaging 1.00
R1721:Aldh3b1 UTSW 19 3921271 splice site probably benign
R1769:Aldh3b1 UTSW 19 3918740 missense probably damaging 1.00
R1868:Aldh3b1 UTSW 19 3921271 splice site probably benign
R1911:Aldh3b1 UTSW 19 3921187 missense probably damaging 0.99
R1912:Aldh3b1 UTSW 19 3921187 missense probably damaging 0.99
R2067:Aldh3b1 UTSW 19 3921755 missense probably benign 0.01
R2913:Aldh3b1 UTSW 19 3921275 splice site probably benign
R4133:Aldh3b1 UTSW 19 3920808 missense probably damaging 1.00
R7764:Aldh3b1 UTSW 19 3921563 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTTCCACCACAGACTGTAGG -3'
(R):5'- TCCATAGAGAATATGCCCCAGG -3'

Sequencing Primer
(F):5'- GCAGGCTAGTTGGACAGTC -3'
(R):5'- AATATGCCCCAGGGTGGAGTTTG -3'
Posted On2016-06-21