Incidental Mutation 'R5129:Uty'
ID394934
Institutional Source Beutler Lab
Gene Symbol Uty
Ensembl Gene ENSMUSG00000068457
Gene Nameubiquitously transcribed tetratricopeptide repeat gene, Y chromosome
SynonymsHydb
MMRRC Submission 042717-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5129 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location1096861-1245759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 1158592 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 484 (T484A)
Ref Sequence ENSEMBL: ENSMUSP00000114752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069309] [ENSMUST00000137048] [ENSMUST00000139365] [ENSMUST00000143286] [ENSMUST00000143958] [ENSMUST00000154004] [ENSMUST00000154666]
Predicted Effect probably benign
Transcript: ENSMUST00000069309
AA Change: T485A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000070012
Gene: ENSMUSG00000068457
AA Change: T485A

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 88 121 1.51e1 SMART
TPR 125 158 2.26e-3 SMART
TPR 200 233 2.31e0 SMART
TPR 279 312 6.19e-1 SMART
TPR 313 346 4.21e-3 SMART
TPR 347 380 8.97e0 SMART
Blast:JmjC 389 470 2e-28 BLAST
low complexity region 534 551 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 784 795 N/A INTRINSIC
JmjC 907 1070 5.22e-47 SMART
Blast:JmjC 1106 1170 1e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133976
Predicted Effect probably benign
Transcript: ENSMUST00000137048
AA Change: T437A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119406
Gene: ENSMUSG00000068457
AA Change: T437A

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 85 118 1.51e1 SMART
TPR 122 155 2.26e-3 SMART
TPR 197 230 2.31e0 SMART
TPR 276 309 6.19e-1 SMART
TPR 310 343 4.21e-3 SMART
TPR 344 377 8.97e0 SMART
Blast:JmjC 452 647 6e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139365
AA Change: T484A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114752
Gene: ENSMUSG00000068457
AA Change: T484A

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 87 120 1.51e1 SMART
TPR 124 157 2.26e-3 SMART
TPR 199 232 2.31e0 SMART
TPR 278 311 6.19e-1 SMART
TPR 312 345 4.21e-3 SMART
TPR 346 379 8.97e0 SMART
Blast:JmjC 388 469 2e-28 BLAST
low complexity region 533 550 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 730 743 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
JmjC 906 1069 5.22e-47 SMART
Blast:JmjC 1105 1169 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143286
AA Change: T384A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115113
Gene: ENSMUSG00000068457
AA Change: T384A

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 69 102 2.26e-3 SMART
TPR 144 177 2.31e0 SMART
TPR 223 256 6.19e-1 SMART
TPR 257 290 4.21e-3 SMART
TPR 291 324 8.97e0 SMART
low complexity region 433 450 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 683 694 N/A INTRINSIC
JmjC 806 969 5.22e-47 SMART
Blast:JmjC 1005 1069 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143958
SMART Domains Protein: ENSMUSP00000120069
Gene: ENSMUSG00000068457

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154004
AA Change: T422A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114910
Gene: ENSMUSG00000068457
AA Change: T422A

DomainStartEndE-ValueType
TPR 25 58 1.51e1 SMART
TPR 62 95 2.26e-3 SMART
TPR 137 170 2.31e0 SMART
TPR 216 249 6.19e-1 SMART
TPR 250 283 4.21e-3 SMART
TPR 284 317 8.97e0 SMART
Blast:JmjC 326 407 2e-28 BLAST
low complexity region 471 488 N/A INTRINSIC
low complexity region 568 583 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 668 681 N/A INTRINSIC
low complexity region 721 732 N/A INTRINSIC
JmjC 844 1007 5.22e-47 SMART
Blast:JmjC 1043 1107 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154666
SMART Domains Protein: ENSMUSP00000122818
Gene: ENSMUSG00000068457

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mutant male mice hemizygous for a gene trapped allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,561,361 noncoding transcript Het
Abcf1 C T 17: 35,960,795 probably benign Het
Adamts14 T A 10: 61,249,618 D209V probably benign Het
Aldh3b1 A G 19: 3,915,336 F392L probably benign Het
Atp1a2 A T 1: 172,275,955 D999E probably benign Het
Capn7 T C 14: 31,344,511 V94A probably damaging Het
Cdh13 A G 8: 119,095,215 D271G probably damaging Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col6a4 T C 9: 106,013,377 E1906G probably damaging Het
Daw1 T C 1: 83,205,903 Y225H probably damaging Het
Dvl3 T A 16: 20,517,340 M49K possibly damaging Het
Eef1b2 T G 1: 63,179,580 S175A probably damaging Het
Epb41l1 A T 2: 156,509,281 Y425F possibly damaging Het
Fam43b A T 4: 138,395,472 L179* probably null Het
Fbxw28 A G 9: 109,326,603 L314P probably damaging Het
Fstl4 C A 11: 53,186,439 D674E probably damaging Het
G3bp1 T C 11: 55,489,116 V92A possibly damaging Het
Gm3604 A T 13: 62,369,774 Y257N probably benign Het
Gm5415 C A 1: 32,545,479 R450M probably damaging Het
Gm5415 T A 1: 32,545,480 R450W probably damaging Het
Gm5900 A G 7: 104,950,016 noncoding transcript Het
Hectd4 G A 5: 121,343,510 V3041M possibly damaging Het
Hivep2 A G 10: 14,130,864 K1069E probably damaging Het
Hlf T C 11: 90,390,252 D38G probably benign Het
Hsd3b7 C A 7: 127,801,134 C18* probably null Het
Kdm5a T C 6: 120,405,022 C676R probably damaging Het
Klhdc7b A G 15: 89,388,548 Y1211C probably damaging Het
Krt78 C A 15: 101,947,580 V599L possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nbas T C 12: 13,390,960 L1097P probably damaging Het
Nf2 A C 11: 4,816,145 D87E probably benign Het
Olfr113 T C 17: 37,575,180 Y81C probably damaging Het
Olfr961 T A 9: 39,647,494 I256N probably benign Het
Ppil3 A G 1: 58,440,833 probably benign Het
Prrc2a T C 17: 35,160,178 E276G unknown Het
Spata16 A G 3: 26,667,564 E78G probably damaging Het
Tlr3 A T 8: 45,402,981 I54K probably damaging Het
Tmem72 A G 6: 116,702,013 L34P probably damaging Het
Triobp A G 15: 78,961,096 R213G probably benign Het
Tyrp1 T A 4: 80,846,607 V7D probably damaging Het
Uhrf2 A G 19: 30,075,221 I372V probably benign Het
Vcan T C 13: 89,690,240 D2395G probably damaging Het
Vmn1r225 T A 17: 20,503,116 I273N probably damaging Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp457 T C 13: 67,293,356 E385G probably benign Het
Zfp74 C T 7: 29,932,455 M121I probably benign Het
Zfp866 A T 8: 69,767,709 probably null Het
Zfp874a A T 13: 67,442,981 C195S probably damaging Het
Other mutations in Uty
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Uty UTSW Y 1197223 missense probably damaging 1.00
R0277:Uty UTSW Y 1169979 missense probably damaging 1.00
R0323:Uty UTSW Y 1169979 missense probably damaging 1.00
R1102:Uty UTSW Y 1174741 missense probably damaging 1.00
R1256:Uty UTSW Y 1134884 missense probably damaging 0.96
R1499:Uty UTSW Y 1197228 missense probably damaging 1.00
R1534:Uty UTSW Y 1245440 missense probably benign 0.41
R1643:Uty UTSW Y 1152054 missense probably damaging 1.00
R2070:Uty UTSW Y 1169193 missense probably benign 0.28
R2101:Uty UTSW Y 1176541 missense probably damaging 0.99
R2146:Uty UTSW Y 1239816 missense probably benign 0.25
R2508:Uty UTSW Y 1158182 missense probably damaging 1.00
R3036:Uty UTSW Y 1099671 nonsense probably null
R3437:Uty UTSW Y 1158336 missense probably benign 0.38
R3547:Uty UTSW Y 1158512 missense possibly damaging 0.78
R4153:Uty UTSW Y 1158327 missense possibly damaging 0.68
R4388:Uty UTSW Y 1151956 missense possibly damaging 0.94
R4467:Uty UTSW Y 1158372 missense possibly damaging 0.48
R4607:Uty UTSW Y 1131134 missense probably damaging 1.00
R4608:Uty UTSW Y 1131134 missense probably damaging 1.00
R4684:Uty UTSW Y 1176502 nonsense probably null
R4948:Uty UTSW Y 1136883 missense probably damaging 1.00
R5387:Uty UTSW Y 1189339 missense probably damaging 1.00
R5408:Uty UTSW Y 1245614 missense possibly damaging 0.46
R5487:Uty UTSW Y 1174825 missense probably damaging 1.00
R5677:Uty UTSW Y 1134902 missense probably damaging 1.00
R5806:Uty UTSW Y 1170921 missense probably damaging 0.99
R6047:Uty UTSW Y 1158288 missense probably damaging 1.00
R6092:Uty UTSW Y 1174836 missense probably benign 0.08
R6759:Uty UTSW Y 1174735 missense probably damaging 0.98
R6761:Uty UTSW Y 1186790 missense probably damaging 1.00
R6949:Uty UTSW Y 1240000 intron probably null
R7177:Uty UTSW Y 1099691 missense probably benign 0.33
R7251:Uty UTSW Y 1154262 missense probably benign
R7469:Uty UTSW Y 1131072 missense possibly damaging 0.71
R7582:Uty UTSW Y 1170914 missense probably damaging 1.00
R7686:Uty UTSW Y 1158075 missense possibly damaging 0.92
R7826:Uty UTSW Y 1137716 missense possibly damaging 0.83
R8225:Uty UTSW Y 1158634 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAAGGCTGGAAATCGGAACTG -3'
(R):5'- GGGCATTAGTAAATGGAATCAGATC -3'

Sequencing Primer
(F):5'- CTGGAAATCGGAACTGATGAGATCTG -3'
(R):5'- TGGAATCAGATCAAGTTTTACTCTG -3'
Posted On2016-06-21