Incidental Mutation 'R5130:Kcna5'
ID394951
Institutional Source Beutler Lab
Gene Symbol Kcna5
Ensembl Gene ENSMUSG00000045534
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 5
SynonymsKv1.5
MMRRC Submission 042718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5130 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126532551-126535412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126534533 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 211 (I211V)
Ref Sequence ENSEMBL: ENSMUSP00000055673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060972]
Predicted Effect probably benign
Transcript: ENSMUST00000060972
AA Change: I211V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000055673
Gene: ENSMUSG00000045534
AA Change: I211V

DomainStartEndE-ValueType
low complexity region 65 80 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
BTB 111 211 5e-7 SMART
Pfam:Ion_trans 240 516 6.6e-54 PFAM
Pfam:Ion_trans_2 424 509 1.4e-15 PFAM
Meta Mutation Damage Score 0.0681 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of familial atrial fibrillation type 7 (ATFB7). [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal microglial proliferation and nitric oxide release after LPS treatment or facial nerve lesion. Mice homozygous for a knock-in allele exhibit impaired hypoxic pulmonary vasoconstriction, and resistance to drug-induced cardiac QT prolongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T C 1: 161,952,615 N110S possibly damaging Het
4932431P20Rik T C 7: 29,529,274 noncoding transcript Het
Acss3 T C 10: 107,004,725 I392V possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef11 A G 3: 87,726,014 H696R possibly damaging Het
Baiap3 G T 17: 25,245,342 D847E probably benign Het
Cdc27 T C 11: 104,534,774 K72R probably benign Het
Cry2 T C 2: 92,424,599 E137G probably benign Het
Dhodh A T 8: 109,595,756 L237Q possibly damaging Het
Dscam A T 16: 96,819,779 N576K probably benign Het
Eng A G 2: 32,681,506 N636S probably damaging Het
Ephx2 A T 14: 66,108,062 I151K probably damaging Het
Fahd1 A G 17: 24,849,759 C115R probably damaging Het
Fer1l4 T A 2: 156,049,466 I143F possibly damaging Het
Iqgap3 C A 3: 88,108,854 N981K probably damaging Het
Mcm9 A T 10: 53,630,399 V14E possibly damaging Het
Mlh1 A G 9: 111,229,838 probably null Het
Mylk A G 16: 34,988,997 K1775E probably damaging Het
Myo18b T C 5: 112,873,903 D541G probably benign Het
Ncapd2 A T 6: 125,169,924 M1233K possibly damaging Het
Nf2 A T 11: 4,829,862 probably benign Het
Nova2 C T 7: 18,926,144 T22I unknown Het
Olfr411 A T 11: 74,347,167 M19K probably damaging Het
Olfr846 T A 9: 19,361,073 Y94F possibly damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcdha2 A T 18: 36,940,669 N451I probably damaging Het
Pcdhb12 T A 18: 37,435,824 F8I probably benign Het
Pdzph1 A C 17: 58,922,609 L1018W probably damaging Het
Prdm9 T C 17: 15,544,467 R684G probably benign Het
Rabep1 T A 11: 70,904,731 V261E probably damaging Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Samd9l A T 6: 3,374,548 D904E possibly damaging Het
Siah3 A T 14: 75,525,941 K211* probably null Het
Slc5a8 T A 10: 88,926,215 N572K probably benign Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Sowahb T A 5: 93,042,771 K696N possibly damaging Het
St7l A T 3: 104,895,764 H330L probably damaging Het
Tnrc6c T A 11: 117,738,350 probably null Het
Ttc28 G T 5: 110,892,856 V37F probably benign Het
Uaca C A 9: 60,880,228 Q1409K probably damaging Het
V1rd19 T A 7: 24,003,112 M1K probably null Het
Vmn1r225 A G 17: 20,502,785 R163G possibly damaging Het
Zc3h3 C A 15: 75,779,290 V694L probably damaging Het
Zfp442 G T 2: 150,409,610 T123K possibly damaging Het
Zmym1 A T 4: 127,048,658 S646T probably damaging Het
Other mutations in Kcna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Kcna5 APN 6 126534509 missense probably damaging 1.00
H8562:Kcna5 UTSW 6 126533423 missense probably damaging 0.98
R0137:Kcna5 UTSW 6 126533383 missense probably damaging 1.00
R0881:Kcna5 UTSW 6 126534994 missense probably benign
R1436:Kcna5 UTSW 6 126534761 missense probably damaging 0.99
R1561:Kcna5 UTSW 6 126534583 missense probably damaging 1.00
R1730:Kcna5 UTSW 6 126533860 missense probably damaging 1.00
R1783:Kcna5 UTSW 6 126533860 missense probably damaging 1.00
R3940:Kcna5 UTSW 6 126533651 missense probably damaging 1.00
R4276:Kcna5 UTSW 6 126533366 missense probably damaging 1.00
R4372:Kcna5 UTSW 6 126533357 makesense probably null
R4562:Kcna5 UTSW 6 126534340 missense probably benign 0.00
R5137:Kcna5 UTSW 6 126533983 missense probably damaging 1.00
R5388:Kcna5 UTSW 6 126534896 missense probably benign 0.04
R5890:Kcna5 UTSW 6 126534736 missense probably damaging 1.00
R7159:Kcna5 UTSW 6 126533629 missense probably damaging 1.00
R7162:Kcna5 UTSW 6 126533843 missense possibly damaging 0.87
R7322:Kcna5 UTSW 6 126533791 missense possibly damaging 0.83
R7353:Kcna5 UTSW 6 126534845 missense probably benign 0.00
R7695:Kcna5 UTSW 6 126534211 missense probably damaging 1.00
R7775:Kcna5 UTSW 6 126534805 nonsense probably null
R7778:Kcna5 UTSW 6 126534805 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTAACAGCTCCCGTTCATC -3'
(R):5'- TCAAACGCCTGCGCTACTTC -3'

Sequencing Primer
(F):5'- GAGAATGACCAAGACCGAC -3'
(R):5'- GAGAAATGAGTACTTCTTCGACCGC -3'
Posted On2016-06-21