Incidental Mutation 'R5130:Mlh1'
ID394959
Institutional Source Beutler Lab
Gene Symbol Mlh1
Ensembl Gene ENSMUSG00000032498
Gene NamemutL homolog 1
Synonymscolon cancer, nonpolyposis type 2, 1110035C23Rik
MMRRC Submission 042718-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5130 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111228228-111271791 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 111229838 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035078] [ENSMUST00000035079] [ENSMUST00000098340] [ENSMUST00000135218] [ENSMUST00000135218]
Predicted Effect probably benign
Transcript: ENSMUST00000035078
SMART Domains Protein: ENSMUSP00000035078
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 340 2.5e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000035079
SMART Domains Protein: ENSMUSP00000035079
Gene: ENSMUSG00000032498

DomainStartEndE-ValueType
HATPase_c 23 158 4.57e-1 SMART
DNA_mis_repair 216 335 1.08e-44 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 429 454 N/A INTRINSIC
Pfam:Mlh1_C 504 760 8.3e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098340
SMART Domains Protein: ENSMUSP00000095944
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 326 2.7e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128795
Predicted Effect probably benign
Transcript: ENSMUST00000135218
Predicted Effect probably benign
Transcript: ENSMUST00000135218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200145
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced pairing in meiotic prophase I and produce no mature germ cells. Mutants also display increased microsatellite instability and a predisposition for developing intestinal and other tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T C 1: 161,952,615 N110S possibly damaging Het
4932431P20Rik T C 7: 29,529,274 noncoding transcript Het
Acss3 T C 10: 107,004,725 I392V possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef11 A G 3: 87,726,014 H696R possibly damaging Het
Baiap3 G T 17: 25,245,342 D847E probably benign Het
Cdc27 T C 11: 104,534,774 K72R probably benign Het
Cry2 T C 2: 92,424,599 E137G probably benign Het
Dhodh A T 8: 109,595,756 L237Q possibly damaging Het
Dscam A T 16: 96,819,779 N576K probably benign Het
Eng A G 2: 32,681,506 N636S probably damaging Het
Ephx2 A T 14: 66,108,062 I151K probably damaging Het
Fahd1 A G 17: 24,849,759 C115R probably damaging Het
Fer1l4 T A 2: 156,049,466 I143F possibly damaging Het
Iqgap3 C A 3: 88,108,854 N981K probably damaging Het
Kcna5 T C 6: 126,534,533 I211V probably benign Het
Mcm9 A T 10: 53,630,399 V14E possibly damaging Het
Mylk A G 16: 34,988,997 K1775E probably damaging Het
Myo18b T C 5: 112,873,903 D541G probably benign Het
Ncapd2 A T 6: 125,169,924 M1233K possibly damaging Het
Nf2 A T 11: 4,829,862 probably benign Het
Nova2 C T 7: 18,926,144 T22I unknown Het
Olfr411 A T 11: 74,347,167 M19K probably damaging Het
Olfr846 T A 9: 19,361,073 Y94F possibly damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcdha2 A T 18: 36,940,669 N451I probably damaging Het
Pcdhb12 T A 18: 37,435,824 F8I probably benign Het
Pdzph1 A C 17: 58,922,609 L1018W probably damaging Het
Prdm9 T C 17: 15,544,467 R684G probably benign Het
Rabep1 T A 11: 70,904,731 V261E probably damaging Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Samd9l A T 6: 3,374,548 D904E possibly damaging Het
Siah3 A T 14: 75,525,941 K211* probably null Het
Slc5a8 T A 10: 88,926,215 N572K probably benign Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Sowahb T A 5: 93,042,771 K696N possibly damaging Het
St7l A T 3: 104,895,764 H330L probably damaging Het
Tnrc6c T A 11: 117,738,350 probably null Het
Ttc28 G T 5: 110,892,856 V37F probably benign Het
Uaca C A 9: 60,880,228 Q1409K probably damaging Het
V1rd19 T A 7: 24,003,112 M1K probably null Het
Vmn1r225 A G 17: 20,502,785 R163G possibly damaging Het
Zc3h3 C A 15: 75,779,290 V694L probably damaging Het
Zfp442 G T 2: 150,409,610 T123K possibly damaging Het
Zmym1 A T 4: 127,048,658 S646T probably damaging Het
Other mutations in Mlh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Mlh1 APN 9 111252912 missense possibly damaging 0.84
IGL02530:Mlh1 APN 9 111229875 missense probably benign 0.09
IGL02811:Mlh1 APN 9 111271514 missense probably benign 0.04
IGL02892:Mlh1 APN 9 111252969 missense probably benign 0.00
IGL03394:Mlh1 APN 9 111268243 missense probably damaging 1.00
andalusia UTSW 9 111271410 makesense probably null
andalusia2 UTSW 9 111271523 start codon destroyed probably null 0.93
andalusia3 UTSW 9 111229838 critical splice donor site probably null
ANU23:Mlh1 UTSW 9 111252912 missense possibly damaging 0.84
PIT4495001:Mlh1 UTSW 9 111247260 missense probably benign 0.00
R0496:Mlh1 UTSW 9 111241556 missense probably benign
R0723:Mlh1 UTSW 9 111271472 missense probably damaging 1.00
R1395:Mlh1 UTSW 9 111247377 missense probably damaging 1.00
R1694:Mlh1 UTSW 9 111228475 missense probably damaging 1.00
R1762:Mlh1 UTSW 9 111229929 missense probably damaging 1.00
R1865:Mlh1 UTSW 9 111257024 intron probably benign
R1885:Mlh1 UTSW 9 111258556 missense probably benign 0.18
R1992:Mlh1 UTSW 9 111228563 missense probably damaging 0.96
R2186:Mlh1 UTSW 9 111258566 unclassified probably benign
R2680:Mlh1 UTSW 9 111236017 critical splice acceptor site probably null
R4693:Mlh1 UTSW 9 111255658 missense probably damaging 1.00
R4784:Mlh1 UTSW 9 111239798 missense probably benign
R5007:Mlh1 UTSW 9 111271410 makesense probably null
R5166:Mlh1 UTSW 9 111241513 missense probably benign 0.04
R5265:Mlh1 UTSW 9 111271523 start codon destroyed probably null 0.93
R5481:Mlh1 UTSW 9 111229837 splice site probably null
R5483:Mlh1 UTSW 9 111231058 missense possibly damaging 0.82
R5602:Mlh1 UTSW 9 111252878 missense probably damaging 0.97
R5658:Mlh1 UTSW 9 111247380 missense probably damaging 0.99
R5890:Mlh1 UTSW 9 111228495 missense possibly damaging 0.88
R6810:Mlh1 UTSW 9 111241558 missense possibly damaging 0.52
R7607:Mlh1 UTSW 9 111229890 missense probably damaging 1.00
R7753:Mlh1 UTSW 9 111252863 critical splice donor site probably null
R7912:Mlh1 UTSW 9 111261513 missense possibly damaging 0.69
R7977:Mlh1 UTSW 9 111230077 intron probably null
R7993:Mlh1 UTSW 9 111261513 missense possibly damaging 0.69
R7995:Mlh1 UTSW 9 111235921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGTCTATGTTCTAGTCCAGCAG -3'
(R):5'- ACTGTTAAAGCCCTGACTGAAC -3'

Sequencing Primer
(F):5'- CGCTATAATCTCAGCACTTAGGAGG -3'
(R):5'- GACTGAACTGAATGCTTGCC -3'
Posted On2016-06-21