Incidental Mutation 'R5130:Olfr411'
ID394966
Institutional Source Beutler Lab
Gene Symbol Olfr411
Ensembl Gene ENSMUSG00000054406
Gene Nameolfactory receptor 411
SynonymsMOR255-3, GA_x6K02T2P1NL-4481525-4480578
MMRRC Submission 042718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5130 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74345129-74352650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74347167 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 19 (M19K)
Ref Sequence ENSEMBL: ENSMUSP00000145878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080365] [ENSMUST00000141134] [ENSMUST00000214769]
Predicted Effect probably damaging
Transcript: ENSMUST00000080365
AA Change: M139K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079235
Gene: ENSMUSG00000054406
AA Change: M139K

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 7.1e-58 PFAM
Pfam:7tm_1 44 293 8.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141134
AA Change: M19K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214769
AA Change: M139K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T C 1: 161,952,615 N110S possibly damaging Het
4932431P20Rik T C 7: 29,529,274 noncoding transcript Het
Acss3 T C 10: 107,004,725 I392V possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef11 A G 3: 87,726,014 H696R possibly damaging Het
Baiap3 G T 17: 25,245,342 D847E probably benign Het
Cdc27 T C 11: 104,534,774 K72R probably benign Het
Cry2 T C 2: 92,424,599 E137G probably benign Het
Dhodh A T 8: 109,595,756 L237Q possibly damaging Het
Dscam A T 16: 96,819,779 N576K probably benign Het
Eng A G 2: 32,681,506 N636S probably damaging Het
Ephx2 A T 14: 66,108,062 I151K probably damaging Het
Fahd1 A G 17: 24,849,759 C115R probably damaging Het
Fer1l4 T A 2: 156,049,466 I143F possibly damaging Het
Iqgap3 C A 3: 88,108,854 N981K probably damaging Het
Kcna5 T C 6: 126,534,533 I211V probably benign Het
Mcm9 A T 10: 53,630,399 V14E possibly damaging Het
Mlh1 A G 9: 111,229,838 probably null Het
Mylk A G 16: 34,988,997 K1775E probably damaging Het
Myo18b T C 5: 112,873,903 D541G probably benign Het
Ncapd2 A T 6: 125,169,924 M1233K possibly damaging Het
Nf2 A T 11: 4,829,862 probably benign Het
Nova2 C T 7: 18,926,144 T22I unknown Het
Olfr846 T A 9: 19,361,073 Y94F possibly damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcdha2 A T 18: 36,940,669 N451I probably damaging Het
Pcdhb12 T A 18: 37,435,824 F8I probably benign Het
Pdzph1 A C 17: 58,922,609 L1018W probably damaging Het
Prdm9 T C 17: 15,544,467 R684G probably benign Het
Rabep1 T A 11: 70,904,731 V261E probably damaging Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Samd9l A T 6: 3,374,548 D904E possibly damaging Het
Siah3 A T 14: 75,525,941 K211* probably null Het
Slc5a8 T A 10: 88,926,215 N572K probably benign Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Sowahb T A 5: 93,042,771 K696N possibly damaging Het
St7l A T 3: 104,895,764 H330L probably damaging Het
Tnrc6c T A 11: 117,738,350 probably null Het
Ttc28 G T 5: 110,892,856 V37F probably benign Het
Uaca C A 9: 60,880,228 Q1409K probably damaging Het
V1rd19 T A 7: 24,003,112 M1K probably null Het
Vmn1r225 A G 17: 20,502,785 R163G possibly damaging Het
Zc3h3 C A 15: 75,779,290 V694L probably damaging Het
Zfp442 G T 2: 150,409,610 T123K possibly damaging Het
Zmym1 A T 4: 127,048,658 S646T probably damaging Het
Other mutations in Olfr411
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr411 APN 11 74347429 missense probably benign 0.00
IGL01308:Olfr411 APN 11 74346660 missense probably damaging 1.00
IGL01596:Olfr411 APN 11 74347419 missense possibly damaging 0.79
IGL02233:Olfr411 APN 11 74347428 missense possibly damaging 0.51
IGL03407:Olfr411 APN 11 74347545 missense possibly damaging 0.47
R0371:Olfr411 UTSW 11 74346934 missense probably damaging 0.99
R0924:Olfr411 UTSW 11 74346798 missense probably damaging 1.00
R0926:Olfr411 UTSW 11 74347306 missense probably benign 0.00
R1265:Olfr411 UTSW 11 74346940 missense probably benign 0.00
R3712:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R4446:Olfr411 UTSW 11 74346762 missense probably benign 0.12
R4669:Olfr411 UTSW 11 74346963 missense probably benign
R4851:Olfr411 UTSW 11 74346943 missense probably benign
R4990:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R4992:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R5171:Olfr411 UTSW 11 74346814 missense probably benign 0.08
R5240:Olfr411 UTSW 11 74347242 missense probably damaging 1.00
R5346:Olfr411 UTSW 11 74346670 missense probably benign 0.00
R5491:Olfr411 UTSW 11 74346914 missense probably benign 0.07
R5723:Olfr411 UTSW 11 74347128 missense possibly damaging 0.66
R6581:Olfr411 UTSW 11 74347206 missense probably damaging 0.98
R7561:Olfr411 UTSW 11 74347610 intron probably benign
Z1177:Olfr411 UTSW 11 74347480 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAATCACAGGTGCACCAG -3'
(R):5'- CCCATCAATGTTGGGTCGTC -3'

Sequencing Primer
(F):5'- ACAGGTGCACCAGCCATGAG -3'
(R):5'- CCATCAATGTTGGGTCGTCTCTTG -3'
Posted On2016-06-21