Incidental Mutation 'R5130:Mylk'
ID 394974
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 042718-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5130 (G1)
Quality Score 221
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34809367 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1775 (K1775E)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023538
AA Change: K1775E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: K1775E

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232482
Meta Mutation Damage Score 0.1744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T C 1: 161,780,184 (GRCm39) N110S possibly damaging Het
Acss3 T C 10: 106,840,586 (GRCm39) I392V possibly damaging Het
Agbl5 G A 5: 31,060,403 (GRCm39) R141Q probably damaging Het
Arhgef11 A G 3: 87,633,321 (GRCm39) H696R possibly damaging Het
Baiap3 G T 17: 25,464,316 (GRCm39) D847E probably benign Het
Cdc27 T C 11: 104,425,600 (GRCm39) K72R probably benign Het
Cry2 T C 2: 92,254,944 (GRCm39) E137G probably benign Het
Dhodh A T 8: 110,322,388 (GRCm39) L237Q possibly damaging Het
Dscam A T 16: 96,620,979 (GRCm39) N576K probably benign Het
Eng A G 2: 32,571,518 (GRCm39) N636S probably damaging Het
Ephx2 A T 14: 66,345,511 (GRCm39) I151K probably damaging Het
Fahd1 A G 17: 25,068,733 (GRCm39) C115R probably damaging Het
Fer1l4 T A 2: 155,891,386 (GRCm39) I143F possibly damaging Het
Iqgap3 C A 3: 88,016,161 (GRCm39) N981K probably damaging Het
Kcna5 T C 6: 126,511,496 (GRCm39) I211V probably benign Het
Mcm9 A T 10: 53,506,495 (GRCm39) V14E possibly damaging Het
Mlh1 A G 9: 111,058,906 (GRCm39) probably null Het
Myo18b T C 5: 113,021,769 (GRCm39) D541G probably benign Het
Ncapd2 A T 6: 125,146,887 (GRCm39) M1233K possibly damaging Het
Nf2 A T 11: 4,779,862 (GRCm39) probably benign Het
Nova2 C T 7: 18,660,069 (GRCm39) T22I unknown Het
Or3a1d A T 11: 74,237,993 (GRCm39) M19K probably damaging Het
Or7g28 T A 9: 19,272,369 (GRCm39) Y94F possibly damaging Het
Or8b12 T A 9: 37,657,805 (GRCm39) I125N probably damaging Het
Pcdha2 A T 18: 37,073,722 (GRCm39) N451I probably damaging Het
Pcdhb12 T A 18: 37,568,877 (GRCm39) F8I probably benign Het
Pdzph1 A C 17: 59,229,604 (GRCm39) L1018W probably damaging Het
Prdm9 T C 17: 15,764,729 (GRCm39) R684G probably benign Het
Rabep1 T A 11: 70,795,557 (GRCm39) V261E probably damaging Het
Ros1 T A 10: 52,040,037 (GRCm39) Y318F possibly damaging Het
Samd9l A T 6: 3,374,548 (GRCm39) D904E possibly damaging Het
Siah3 A T 14: 75,763,381 (GRCm39) K211* probably null Het
Slc5a8 T A 10: 88,762,077 (GRCm39) N572K probably benign Het
Slfn8 A G 11: 82,894,647 (GRCm39) F664S probably benign Het
Sowahb T A 5: 93,190,630 (GRCm39) K696N possibly damaging Het
St7l A T 3: 104,803,080 (GRCm39) H330L probably damaging Het
Tnrc6c T A 11: 117,629,176 (GRCm39) probably null Het
Ttc28 G T 5: 111,040,722 (GRCm39) V37F probably benign Het
Uaca C A 9: 60,787,510 (GRCm39) Q1409K probably damaging Het
V1rd19 T A 7: 23,702,537 (GRCm39) M1K probably null Het
Vmn1r225 A G 17: 20,723,047 (GRCm39) R163G possibly damaging Het
Wdr87-ps T C 7: 29,228,699 (GRCm39) noncoding transcript Het
Zc3h3 C A 15: 75,651,139 (GRCm39) V694L probably damaging Het
Zfp442 G T 2: 150,251,530 (GRCm39) T123K possibly damaging Het
Zmym1 A T 4: 126,942,451 (GRCm39) S646T probably damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GTTGTGTCCCATGTAACCTGGG -3'
(R):5'- TGGACACAGGTCATTGCAGAAAC -3'

Sequencing Primer
(F):5'- GGGACAGATGTCATCCCATTTG -3'
(R):5'- CAGGTCATTGCAGAAACAAATTC -3'
Posted On 2016-06-21