Incidental Mutation 'R5130:Vmn1r225'
ID394977
Institutional Source Beutler Lab
Gene Symbol Vmn1r225
Ensembl Gene ENSMUSG00000043537
Gene Namevomeronasal 1 receptor 225
SynonymsV1re5
MMRRC Submission 042718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5130 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20502299-20503195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20502785 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 163 (R163G)
Ref Sequence ENSEMBL: ENSMUSP00000056068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061660
AA Change: R163G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056068
Gene: ENSMUSG00000043537
AA Change: R163G

DomainStartEndE-ValueType
Pfam:TAS2R 1 287 8.9e-15 PFAM
Pfam:V1R 11 291 3.1e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T C 1: 161,952,615 N110S possibly damaging Het
4932431P20Rik T C 7: 29,529,274 noncoding transcript Het
Acss3 T C 10: 107,004,725 I392V possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef11 A G 3: 87,726,014 H696R possibly damaging Het
Baiap3 G T 17: 25,245,342 D847E probably benign Het
Cdc27 T C 11: 104,534,774 K72R probably benign Het
Cry2 T C 2: 92,424,599 E137G probably benign Het
Dhodh A T 8: 109,595,756 L237Q possibly damaging Het
Dscam A T 16: 96,819,779 N576K probably benign Het
Eng A G 2: 32,681,506 N636S probably damaging Het
Ephx2 A T 14: 66,108,062 I151K probably damaging Het
Fahd1 A G 17: 24,849,759 C115R probably damaging Het
Fer1l4 T A 2: 156,049,466 I143F possibly damaging Het
Iqgap3 C A 3: 88,108,854 N981K probably damaging Het
Kcna5 T C 6: 126,534,533 I211V probably benign Het
Mcm9 A T 10: 53,630,399 V14E possibly damaging Het
Mlh1 A G 9: 111,229,838 probably null Het
Mylk A G 16: 34,988,997 K1775E probably damaging Het
Myo18b T C 5: 112,873,903 D541G probably benign Het
Ncapd2 A T 6: 125,169,924 M1233K possibly damaging Het
Nf2 A T 11: 4,829,862 probably benign Het
Nova2 C T 7: 18,926,144 T22I unknown Het
Olfr411 A T 11: 74,347,167 M19K probably damaging Het
Olfr846 T A 9: 19,361,073 Y94F possibly damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcdha2 A T 18: 36,940,669 N451I probably damaging Het
Pcdhb12 T A 18: 37,435,824 F8I probably benign Het
Pdzph1 A C 17: 58,922,609 L1018W probably damaging Het
Prdm9 T C 17: 15,544,467 R684G probably benign Het
Rabep1 T A 11: 70,904,731 V261E probably damaging Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Samd9l A T 6: 3,374,548 D904E possibly damaging Het
Siah3 A T 14: 75,525,941 K211* probably null Het
Slc5a8 T A 10: 88,926,215 N572K probably benign Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Sowahb T A 5: 93,042,771 K696N possibly damaging Het
St7l A T 3: 104,895,764 H330L probably damaging Het
Tnrc6c T A 11: 117,738,350 probably null Het
Ttc28 G T 5: 110,892,856 V37F probably benign Het
Uaca C A 9: 60,880,228 Q1409K probably damaging Het
V1rd19 T A 7: 24,003,112 M1K probably null Het
Zc3h3 C A 15: 75,779,290 V694L probably damaging Het
Zfp442 G T 2: 150,409,610 T123K possibly damaging Het
Zmym1 A T 4: 127,048,658 S646T probably damaging Het
Other mutations in Vmn1r225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Vmn1r225 APN 17 20502819 missense probably damaging 1.00
IGL01830:Vmn1r225 APN 17 20502455 missense probably damaging 0.96
IGL02943:Vmn1r225 APN 17 20502305 missense possibly damaging 0.67
R0544:Vmn1r225 UTSW 17 20502456 missense probably benign 0.44
R1126:Vmn1r225 UTSW 17 20502326 missense probably benign 0.03
R1809:Vmn1r225 UTSW 17 20502656 missense probably benign 0.04
R1928:Vmn1r225 UTSW 17 20502809 missense probably benign 0.00
R2044:Vmn1r225 UTSW 17 20502590 missense possibly damaging 0.50
R2191:Vmn1r225 UTSW 17 20502885 missense probably damaging 0.98
R2206:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R2207:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R2680:Vmn1r225 UTSW 17 20502793 missense probably benign 0.00
R3740:Vmn1r225 UTSW 17 20502999 missense possibly damaging 0.56
R3807:Vmn1r225 UTSW 17 20502852 nonsense probably null
R4196:Vmn1r225 UTSW 17 20502975 missense probably benign 0.00
R4970:Vmn1r225 UTSW 17 20502569 missense possibly damaging 0.74
R5129:Vmn1r225 UTSW 17 20503116 missense probably damaging 1.00
R5187:Vmn1r225 UTSW 17 20502915 missense probably damaging 0.96
R5580:Vmn1r225 UTSW 17 20502839 missense probably damaging 1.00
R6563:Vmn1r225 UTSW 17 20502501 missense probably benign 0.03
R6674:Vmn1r225 UTSW 17 20503115 missense probably benign 0.06
R7003:Vmn1r225 UTSW 17 20503154 missense probably null 0.01
R7143:Vmn1r225 UTSW 17 20502384 missense probably benign 0.22
R7422:Vmn1r225 UTSW 17 20502797 missense probably benign 0.25
R7651:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R7952:Vmn1r225 UTSW 17 20502327 missense probably damaging 0.98
R8097:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R8696:Vmn1r225 UTSW 17 20503157 missense probably damaging 1.00
R8823:Vmn1r225 UTSW 17 20502561 missense probably benign 0.08
Z1177:Vmn1r225 UTSW 17 20502491 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ATGTCCATCAGCACCACCTG -3'
(R):5'- AGACATTCGTTGTGAAGCATGTG -3'

Sequencing Primer
(F):5'- GAGTGTCTTTCAGGCAATCAC -3'
(R):5'- GTGTGCTAAGAATACCTTGAACCCTC -3'
Posted On2016-06-21