Incidental Mutation 'R5130:Pdzph1'
ID 394980
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 042718-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R5130 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 59229604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 1018 (L1018W)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably damaging
Transcript: ENSMUST00000025064
AA Change: L1018W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: L1018W

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T C 1: 161,780,184 (GRCm39) N110S possibly damaging Het
Acss3 T C 10: 106,840,586 (GRCm39) I392V possibly damaging Het
Agbl5 G A 5: 31,060,403 (GRCm39) R141Q probably damaging Het
Arhgef11 A G 3: 87,633,321 (GRCm39) H696R possibly damaging Het
Baiap3 G T 17: 25,464,316 (GRCm39) D847E probably benign Het
Cdc27 T C 11: 104,425,600 (GRCm39) K72R probably benign Het
Cry2 T C 2: 92,254,944 (GRCm39) E137G probably benign Het
Dhodh A T 8: 110,322,388 (GRCm39) L237Q possibly damaging Het
Dscam A T 16: 96,620,979 (GRCm39) N576K probably benign Het
Eng A G 2: 32,571,518 (GRCm39) N636S probably damaging Het
Ephx2 A T 14: 66,345,511 (GRCm39) I151K probably damaging Het
Fahd1 A G 17: 25,068,733 (GRCm39) C115R probably damaging Het
Fer1l4 T A 2: 155,891,386 (GRCm39) I143F possibly damaging Het
Iqgap3 C A 3: 88,016,161 (GRCm39) N981K probably damaging Het
Kcna5 T C 6: 126,511,496 (GRCm39) I211V probably benign Het
Mcm9 A T 10: 53,506,495 (GRCm39) V14E possibly damaging Het
Mlh1 A G 9: 111,058,906 (GRCm39) probably null Het
Mylk A G 16: 34,809,367 (GRCm39) K1775E probably damaging Het
Myo18b T C 5: 113,021,769 (GRCm39) D541G probably benign Het
Ncapd2 A T 6: 125,146,887 (GRCm39) M1233K possibly damaging Het
Nf2 A T 11: 4,779,862 (GRCm39) probably benign Het
Nova2 C T 7: 18,660,069 (GRCm39) T22I unknown Het
Or3a1d A T 11: 74,237,993 (GRCm39) M19K probably damaging Het
Or7g28 T A 9: 19,272,369 (GRCm39) Y94F possibly damaging Het
Or8b12 T A 9: 37,657,805 (GRCm39) I125N probably damaging Het
Pcdha2 A T 18: 37,073,722 (GRCm39) N451I probably damaging Het
Pcdhb12 T A 18: 37,568,877 (GRCm39) F8I probably benign Het
Prdm9 T C 17: 15,764,729 (GRCm39) R684G probably benign Het
Rabep1 T A 11: 70,795,557 (GRCm39) V261E probably damaging Het
Ros1 T A 10: 52,040,037 (GRCm39) Y318F possibly damaging Het
Samd9l A T 6: 3,374,548 (GRCm39) D904E possibly damaging Het
Siah3 A T 14: 75,763,381 (GRCm39) K211* probably null Het
Slc5a8 T A 10: 88,762,077 (GRCm39) N572K probably benign Het
Slfn8 A G 11: 82,894,647 (GRCm39) F664S probably benign Het
Sowahb T A 5: 93,190,630 (GRCm39) K696N possibly damaging Het
St7l A T 3: 104,803,080 (GRCm39) H330L probably damaging Het
Tnrc6c T A 11: 117,629,176 (GRCm39) probably null Het
Ttc28 G T 5: 111,040,722 (GRCm39) V37F probably benign Het
Uaca C A 9: 60,787,510 (GRCm39) Q1409K probably damaging Het
V1rd19 T A 7: 23,702,537 (GRCm39) M1K probably null Het
Vmn1r225 A G 17: 20,723,047 (GRCm39) R163G possibly damaging Het
Wdr87-ps T C 7: 29,228,699 (GRCm39) noncoding transcript Het
Zc3h3 C A 15: 75,651,139 (GRCm39) V694L probably damaging Het
Zfp442 G T 2: 150,251,530 (GRCm39) T123K possibly damaging Het
Zmym1 A T 4: 126,942,451 (GRCm39) S646T probably damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACAATTCCTGGACAGTCAAGTG -3'
(R):5'- GCATAGTCACTGCCTCTCTAGAAG -3'

Sequencing Primer
(F):5'- TTCCTGGACAGTCAAGTGGGAAAC -3'
(R):5'- ACTGCCTCTCTAGAAGATGTCAGG -3'
Posted On 2016-06-21