Incidental Mutation 'R5131:Gpr1'
ID394984
Institutional Source Beutler Lab
Gene Symbol Gpr1
Ensembl Gene ENSMUSG00000046856
Gene NameG protein-coupled receptor 1
Synonyms
MMRRC Submission 042719-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5131 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63182691-63214543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63183681 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 132 (S132C)
Ref Sequence ENSEMBL: ENSMUSP00000051417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027108] [ENSMUST00000050536] [ENSMUST00000129339] [ENSMUST00000135877] [ENSMUST00000142062] [ENSMUST00000174890] [ENSMUST00000188524]
Predicted Effect probably benign
Transcript: ENSMUST00000027108
Predicted Effect probably damaging
Transcript: ENSMUST00000050536
AA Change: S132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051417
Gene: ENSMUSG00000046856
AA Change: S132C

DomainStartEndE-ValueType
Pfam:7tm_1 55 302 3.9e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082678
Predicted Effect probably benign
Transcript: ENSMUST00000126795
SMART Domains Protein: ENSMUSP00000134341
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
SCOP:d1aw9_1 4 62 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129339
SMART Domains Protein: ENSMUSP00000116492
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 103 130 2.53e-4 SMART
EF1_GNE 139 225 3.86e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135877
SMART Domains Protein: ENSMUSP00000137671
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142062
Predicted Effect probably benign
Transcript: ENSMUST00000174890
SMART Domains Protein: ENSMUSP00000133545
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
Blast:WHEP 3 64 3e-6 BLAST
SCOP:d1aw9_1 7 65 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188524
SMART Domains Protein: ENSMUSP00000140895
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 62 89 1.2e-8 SMART
EF1_GNE 98 184 2.9e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199062
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 C T 4: 40,163,797 P17S probably benign Het
Arhgap35 A G 7: 16,511,187 probably null Het
Brd3 A T 2: 27,453,415 N480K probably benign Het
Ccnk T C 12: 108,202,631 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh1 T C 8: 106,663,798 V590A possibly damaging Het
Cic TCCCCC TCCCCCCCC 7: 25,291,670 probably benign Het
Col4a3bp A G 13: 96,614,835 D331G probably damaging Het
Cyp4a12a T A 4: 115,327,820 D399E possibly damaging Het
Dnah11 A C 12: 117,954,751 Y3482D probably damaging Het
Gm5615 C T 9: 36,534,946 A57T possibly damaging Het
Gtf3c3 A T 1: 54,419,498 probably null Het
Gzmk G T 13: 113,173,948 A73E probably benign Het
Hnrnpul1 A G 7: 25,726,794 V444A probably benign Het
Lgr4 T C 2: 110,012,333 S864P probably benign Het
Lrp2 A T 2: 69,430,342 V4515E possibly damaging Het
Map3k19 A T 1: 127,823,690 N641K possibly damaging Het
Mesp2 A G 7: 79,811,727 T267A possibly damaging Het
Mipep T C 14: 60,903,374 L682P probably damaging Het
Nalcn G T 14: 123,515,770 T268K probably damaging Het
Ncam2 T C 16: 81,437,662 V135A probably benign Het
Ndufaf6 G T 4: 11,060,931 T215K probably damaging Het
Nr1h4 T C 10: 89,483,455 D183G probably damaging Het
Pax2 G T 19: 44,760,955 V41L probably damaging Het
Pde4dip T A 3: 97,709,514 N1804I probably damaging Het
Phtf2 A T 5: 20,774,052 V526E probably damaging Het
Ppp1ca G A 19: 4,194,896 C291Y probably damaging Het
Prag1 G T 8: 36,139,969 G955C probably damaging Het
Psap T A 10: 60,299,957 V394E possibly damaging Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rnf181 G A 6: 72,360,828 probably null Het
Rsbn1l G A 5: 20,896,245 R766C possibly damaging Het
Rusc2 C T 4: 43,414,948 P85S probably benign Het
Rxfp1 T C 3: 79,652,164 probably null Het
Serpinb6a T A 13: 33,918,872 M202L probably benign Het
Snd1 T C 6: 28,885,050 F800S probably damaging Het
Tbc1d2b G A 9: 90,209,759 T830I probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmtc3 T C 10: 100,448,979 D598G probably damaging Het
Ube3b A G 5: 114,407,546 D622G probably damaging Het
Zbtb43 A T 2: 33,454,766 M112K probably damaging Het
Other mutations in Gpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Gpr1 APN 1 63183338 missense probably damaging 0.99
IGL01086:Gpr1 APN 1 63183491 missense probably benign 0.01
IGL01490:Gpr1 APN 1 63183296 missense probably damaging 0.99
IGL02409:Gpr1 APN 1 63183716 missense probably damaging 1.00
IGL02426:Gpr1 APN 1 63183668 missense probably damaging 0.97
R0218:Gpr1 UTSW 1 63183531 missense probably benign 0.25
R2088:Gpr1 UTSW 1 63183652 unclassified probably null
R2166:Gpr1 UTSW 1 63183948 missense probably benign
R2895:Gpr1 UTSW 1 63183162 missense probably benign 0.24
R2896:Gpr1 UTSW 1 63183162 missense probably benign 0.24
R5102:Gpr1 UTSW 1 63183167 missense probably damaging 0.99
R5471:Gpr1 UTSW 1 63183899 missense probably damaging 1.00
R5652:Gpr1 UTSW 1 63183467 missense probably benign 0.00
R6187:Gpr1 UTSW 1 63183275 missense probably damaging 1.00
X0060:Gpr1 UTSW 1 63183059 missense probably benign 0.02
Z1177:Gpr1 UTSW 1 63183639 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGAACTTCACCCAGGTCAG -3'
(R):5'- GGTTCCTCAATCTGGCCATC -3'

Sequencing Primer
(F):5'- CAGGTCAGAACATGGTGTCTCATC -3'
(R):5'- AATCTGGCCATCGCAGACTTC -3'
Posted On2016-06-21