Incidental Mutation 'R5131:Brd3'
ID394986
Institutional Source Beutler Lab
Gene Symbol Brd3
Ensembl Gene ENSMUSG00000026918
Gene Namebromodomain containing 3
SynonymsRINGL3, ORFX, 2410084F24Rik, Fsrg2
MMRRC Submission 042719-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.542) question?
Stock #R5131 (G1)
Quality Score181
Status Not validated
Chromosome2
Chromosomal Location27445579-27507662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27453415 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 480 (N480K)
Ref Sequence ENSEMBL: ENSMUSP00000114422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028282] [ENSMUST00000077737] [ENSMUST00000113941] [ENSMUST00000138693] [ENSMUST00000154316] [ENSMUST00000164296]
Predicted Effect probably benign
Transcript: ENSMUST00000028282
SMART Domains Protein: ENSMUSP00000028282
Gene: ENSMUSG00000026918

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
PDB:2JNS|A 572 645 5e-37 PDB
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077737
SMART Domains Protein: ENSMUSP00000076918
Gene: ENSMUSG00000026918

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
PDB:2JNS|A 572 645 5e-37 PDB
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113941
AA Change: N480K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109574
Gene: ENSMUSG00000026918
AA Change: N480K

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
Pfam:BET 589 653 1.2e-35 PFAM
coiled coil region 666 701 N/A INTRINSIC
low complexity region 708 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130932
Predicted Effect probably benign
Transcript: ENSMUST00000138693
AA Change: N480K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115755
Gene: ENSMUSG00000026918
AA Change: N480K

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
PDB:2JNS|A 589 662 4e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154316
AA Change: N480K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114422
Gene: ENSMUSG00000026918
AA Change: N480K

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
PDB:2JNS|A 589 662 4e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164296
SMART Domains Protein: ENSMUSP00000128812
Gene: ENSMUSG00000026918

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
Pfam:BET 572 636 1.5e-35 PFAM
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183455
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on its homology to the gene encoding the RING3 protein, a serine/threonine kinase. The gene localizes to 9q34, a region which contains several major histocompatibility complex (MHC) genes. The function of the encoded protein is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 C T 4: 40,163,797 P17S probably benign Het
Arhgap35 A G 7: 16,511,187 probably null Het
Ccnk T C 12: 108,202,631 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh1 T C 8: 106,663,798 V590A possibly damaging Het
Cic TCCCCC TCCCCCCCC 7: 25,291,670 probably benign Het
Col4a3bp A G 13: 96,614,835 D331G probably damaging Het
Cyp4a12a T A 4: 115,327,820 D399E possibly damaging Het
Dnah11 A C 12: 117,954,751 Y3482D probably damaging Het
Gm5615 C T 9: 36,534,946 A57T possibly damaging Het
Gpr1 T A 1: 63,183,681 S132C probably damaging Het
Gtf3c3 A T 1: 54,419,498 probably null Het
Gzmk G T 13: 113,173,948 A73E probably benign Het
Hnrnpul1 A G 7: 25,726,794 V444A probably benign Het
Lgr4 T C 2: 110,012,333 S864P probably benign Het
Lrp2 A T 2: 69,430,342 V4515E possibly damaging Het
Map3k19 A T 1: 127,823,690 N641K possibly damaging Het
Mesp2 A G 7: 79,811,727 T267A possibly damaging Het
Mipep T C 14: 60,903,374 L682P probably damaging Het
Nalcn G T 14: 123,515,770 T268K probably damaging Het
Ncam2 T C 16: 81,437,662 V135A probably benign Het
Ndufaf6 G T 4: 11,060,931 T215K probably damaging Het
Nr1h4 T C 10: 89,483,455 D183G probably damaging Het
Pax2 G T 19: 44,760,955 V41L probably damaging Het
Pde4dip T A 3: 97,709,514 N1804I probably damaging Het
Phtf2 A T 5: 20,774,052 V526E probably damaging Het
Ppp1ca G A 19: 4,194,896 C291Y probably damaging Het
Prag1 G T 8: 36,139,969 G955C probably damaging Het
Psap T A 10: 60,299,957 V394E possibly damaging Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rnf181 G A 6: 72,360,828 probably null Het
Rsbn1l G A 5: 20,896,245 R766C possibly damaging Het
Rusc2 C T 4: 43,414,948 P85S probably benign Het
Rxfp1 T C 3: 79,652,164 probably null Het
Serpinb6a T A 13: 33,918,872 M202L probably benign Het
Snd1 T C 6: 28,885,050 F800S probably damaging Het
Tbc1d2b G A 9: 90,209,759 T830I probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmtc3 T C 10: 100,448,979 D598G probably damaging Het
Ube3b A G 5: 114,407,546 D622G probably damaging Het
Zbtb43 A T 2: 33,454,766 M112K probably damaging Het
Other mutations in Brd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Brd3 APN 2 27464089 missense possibly damaging 0.53
IGL01685:Brd3 APN 2 27459488 missense probably damaging 1.00
IGL01911:Brd3 APN 2 27459800 missense probably damaging 1.00
IGL02105:Brd3 APN 2 27459776 missense probably damaging 1.00
IGL02649:Brd3 APN 2 27454350 missense probably damaging 1.00
IGL02715:Brd3 APN 2 27454483 missense possibly damaging 0.66
IGL02825:Brd3 APN 2 27449263 missense probably damaging 1.00
IGL02898:Brd3 APN 2 27459741 missense possibly damaging 0.81
H8562:Brd3 UTSW 2 27450533 missense possibly damaging 0.53
R1263:Brd3 UTSW 2 27462522 missense probably damaging 1.00
R1449:Brd3 UTSW 2 27450251 splice site probably null
R1449:Brd3 UTSW 2 27457016 missense probably damaging 1.00
R4351:Brd3 UTSW 2 27457016 missense probably damaging 1.00
R4840:Brd3 UTSW 2 27449239 missense possibly damaging 0.94
R5049:Brd3 UTSW 2 27450577 intron probably benign
R5185:Brd3 UTSW 2 27462448 missense probably damaging 1.00
R5213:Brd3 UTSW 2 27463948 missense possibly damaging 0.81
R5261:Brd3 UTSW 2 27463919 missense probably damaging 0.99
R5326:Brd3 UTSW 2 27450544 missense probably benign
R5661:Brd3 UTSW 2 27461572 missense possibly damaging 0.68
R6439:Brd3 UTSW 2 27463926 missense probably damaging 1.00
R6952:Brd3 UTSW 2 27454359 missense probably damaging 1.00
R7039:Brd3 UTSW 2 27456917 missense probably damaging 0.96
R7103:Brd3 UTSW 2 27450394 missense probably damaging 0.97
R7168:Brd3 UTSW 2 27454399 missense possibly damaging 0.87
R7730:Brd3 UTSW 2 27456955 missense probably damaging 1.00
R7960:Brd3 UTSW 2 27452933 missense probably benign 0.03
R8272:Brd3 UTSW 2 27461713 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTGAACCTGTTCACTCACCTATGG -3'
(R):5'- ATGGTACCTTCCCCTGTTGG -3'

Sequencing Primer
(F):5'- TTCACTCACCTATGGGGGACAG -3'
(R):5'- CTTTTCCTGAGGTACCCAGGAG -3'
Posted On2016-06-21