Incidental Mutation 'R5131:Rap1b'
ID395012
Institutional Source Beutler Lab
Gene Symbol Rap1b
Ensembl Gene ENSMUSG00000052681
Gene NameRAS related protein 1b
Synonyms
MMRRC Submission 042719-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R5131 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location117813871-117846035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117824611 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 14 (V14I)
Ref Sequence ENSEMBL: ENSMUSP00000066238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064667]
Predicted Effect probably damaging
Transcript: ENSMUST00000064667
AA Change: V14I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066238
Gene: ENSMUSG00000052681
AA Change: V14I

DomainStartEndE-ValueType
RAS 1 168 2.4e-122 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and perinatal lethality, abdominal, cranial, and hepatic bleeding in mice that die in utero, reduced platelet aggregation, and decreased thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 C T 4: 40,163,797 P17S probably benign Het
Arhgap35 A G 7: 16,511,187 probably null Het
Brd3 A T 2: 27,453,415 N480K probably benign Het
Ccnk T C 12: 108,202,631 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh1 T C 8: 106,663,798 V590A possibly damaging Het
Cic TCCCCC TCCCCCCCC 7: 25,291,670 probably benign Het
Col4a3bp A G 13: 96,614,835 D331G probably damaging Het
Cyp4a12a T A 4: 115,327,820 D399E possibly damaging Het
Dnah11 A C 12: 117,954,751 Y3482D probably damaging Het
Gm5615 C T 9: 36,534,946 A57T possibly damaging Het
Gpr1 T A 1: 63,183,681 S132C probably damaging Het
Gtf3c3 A T 1: 54,419,498 probably null Het
Gzmk G T 13: 113,173,948 A73E probably benign Het
Hnrnpul1 A G 7: 25,726,794 V444A probably benign Het
Lgr4 T C 2: 110,012,333 S864P probably benign Het
Lrp2 A T 2: 69,430,342 V4515E possibly damaging Het
Map3k19 A T 1: 127,823,690 N641K possibly damaging Het
Mesp2 A G 7: 79,811,727 T267A possibly damaging Het
Mipep T C 14: 60,903,374 L682P probably damaging Het
Nalcn G T 14: 123,515,770 T268K probably damaging Het
Ncam2 T C 16: 81,437,662 V135A probably benign Het
Ndufaf6 G T 4: 11,060,931 T215K probably damaging Het
Nr1h4 T C 10: 89,483,455 D183G probably damaging Het
Pax2 G T 19: 44,760,955 V41L probably damaging Het
Pde4dip T A 3: 97,709,514 N1804I probably damaging Het
Phtf2 A T 5: 20,774,052 V526E probably damaging Het
Ppp1ca G A 19: 4,194,896 C291Y probably damaging Het
Prag1 G T 8: 36,139,969 G955C probably damaging Het
Psap T A 10: 60,299,957 V394E possibly damaging Het
Rnf181 G A 6: 72,360,828 probably null Het
Rsbn1l G A 5: 20,896,245 R766C possibly damaging Het
Rusc2 C T 4: 43,414,948 P85S probably benign Het
Rxfp1 T C 3: 79,652,164 probably null Het
Serpinb6a T A 13: 33,918,872 M202L probably benign Het
Snd1 T C 6: 28,885,050 F800S probably damaging Het
Tbc1d2b G A 9: 90,209,759 T830I probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmtc3 T C 10: 100,448,979 D598G probably damaging Het
Ube3b A G 5: 114,407,546 D622G probably damaging Het
Zbtb43 A T 2: 33,454,766 M112K probably damaging Het
Other mutations in Rap1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Rap1b APN 10 117822860 missense probably damaging 1.00
IGL02539:Rap1b APN 10 117822804 missense possibly damaging 0.82
IGL03286:Rap1b APN 10 117818575 nonsense probably null
R0591:Rap1b UTSW 10 117818617 unclassified probably benign
R1939:Rap1b UTSW 10 117818586 missense probably damaging 1.00
R2509:Rap1b UTSW 10 117818539 missense probably damaging 0.98
R2902:Rap1b UTSW 10 117824602 missense probably damaging 1.00
R4825:Rap1b UTSW 10 117818582 missense probably benign 0.04
R6084:Rap1b UTSW 10 117824611 missense probably damaging 0.96
R6186:Rap1b UTSW 10 117820552 missense probably damaging 1.00
R6737:Rap1b UTSW 10 117822808 missense probably damaging 0.97
R7026:Rap1b UTSW 10 117818479 missense probably benign 0.01
R7530:Rap1b UTSW 10 117817452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATCTTACCTTAATCAGACCAAGAC -3'
(R):5'- GCTCCCATGGGAATCTAGTCTAG -3'

Sequencing Primer
(F):5'- GTGGCCTTTAAAGCTGCAAC -3'
(R):5'- CCCATGGGAATCTAGTCTAGTAATC -3'
Posted On2016-06-21