Incidental Mutation 'R5144:Arpc2'
ID395027
Institutional Source Beutler Lab
Gene Symbol Arpc2
Ensembl Gene ENSMUSG00000006304
Gene Nameactin related protein 2/3 complex, subunit 2
Synonymsp34-Arc, 2210023N03Rik
MMRRC Submission 042728-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5144 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74236084-74268209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74248208 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 62 (K62N)
Ref Sequence ENSEMBL: ENSMUSP00000109451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006467] [ENSMUST00000113819] [ENSMUST00000113820]
Predicted Effect probably damaging
Transcript: ENSMUST00000006467
AA Change: K62N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006467
Gene: ENSMUSG00000006304
AA Change: K62N

DomainStartEndE-ValueType
Pfam:P34-Arc 57 284 3.7e-107 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113819
AA Change: K46N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109450
Gene: ENSMUSG00000006304
AA Change: K46N

DomainStartEndE-ValueType
Pfam:P34-Arc 40 270 4.3e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113820
AA Change: K62N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109451
Gene: ENSMUSG00000006304
AA Change: K62N

DomainStartEndE-ValueType
Pfam:P34-Arc 56 286 4.2e-106 PFAM
Meta Mutation Damage Score 0.6984 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p34 subunit, has yet to be determined. Two alternatively spliced variants have been characterized to date. Additional alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik C A 15: 98,585,267 probably null Het
4933409G03Rik T A 2: 68,616,260 probably benign Het
B4galt5 C T 2: 167,306,596 E201K possibly damaging Het
Bub1b C T 2: 118,615,499 T334M possibly damaging Het
Ccdc71 T C 9: 108,463,852 V288A probably benign Het
Cep350 G A 1: 155,911,150 R1444W probably damaging Het
Chrna4 A G 2: 181,024,830 L605P probably damaging Het
Col6a5 T A 9: 105,889,283 I1813F probably damaging Het
Col9a1 A G 1: 24,239,353 I821V probably benign Het
D430041D05Rik T C 2: 104,258,502 D43G probably damaging Het
Depdc7 T C 2: 104,730,253 Y132C probably damaging Het
Dppa2 T C 16: 48,317,303 V216A probably damaging Het
Ect2l A T 10: 18,144,577 N598K probably benign Het
Eif3c T C 7: 126,563,066 T195A probably benign Het
Epg5 T C 18: 78,015,680 V1883A probably damaging Het
Ino80c T A 18: 24,108,878 D150V probably benign Het
Kcnb1 T A 2: 167,105,944 Y328F probably damaging Het
Kcnj3 G A 2: 55,447,047 probably null Het
Ncor1 T G 11: 62,349,464 S894R probably damaging Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Nudt19 T C 7: 35,555,225 T194A probably benign Het
Olfr350 A T 2: 36,850,144 T33S probably benign Het
Olfr920 C T 9: 38,756,393 S235L possibly damaging Het
Pappa2 T A 1: 158,957,133 R102S probably benign Het
Pik3c2a T C 7: 116,350,786 N1332S probably benign Het
Plppr1 T A 4: 49,319,800 V142E possibly damaging Het
Prdm6 C A 18: 53,465,038 probably benign Het
Prm2 T A 16: 10,791,868 probably benign Het
Prmt3 T C 7: 49,786,135 S155P possibly damaging Het
Rars2 T C 4: 34,656,793 Y481H probably benign Het
Rgs2 G A 1: 144,001,699 T206M probably benign Het
Slc2a8 C T 2: 32,981,773 R56H probably damaging Het
Stk35 T A 2: 129,810,935 M452K probably damaging Het
Tcf3 G A 10: 80,415,237 H454Y probably damaging Het
Tgm3 C T 2: 130,048,282 S655F possibly damaging Het
Tssc4 T G 7: 143,070,033 L26R probably damaging Het
Utp11 A T 4: 124,678,902 probably benign Het
Vmn1r237 C G 17: 21,314,426 A137G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T C 16: 21,559,353 L1038P probably damaging Het
Wipf3 C T 6: 54,485,675 A290V probably damaging Het
Zdhhc25 T G 15: 88,601,056 L198R probably damaging Het
Zdhhc6 A T 19: 55,314,566 M1K probably null Het
Other mutations in Arpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Arpc2 APN 1 74248179 missense probably benign
R0220:Arpc2 UTSW 1 74248134 missense probably damaging 1.00
R0364:Arpc2 UTSW 1 74236887 missense probably null
R1695:Arpc2 UTSW 1 74248232 missense probably damaging 0.97
R4183:Arpc2 UTSW 1 74248163 missense probably damaging 0.99
R5438:Arpc2 UTSW 1 74236836 missense probably null 1.00
R5775:Arpc2 UTSW 1 74255949 splice site probably null
R6017:Arpc2 UTSW 1 74262486 missense probably benign
R7173:Arpc2 UTSW 1 74264372 missense probably damaging 1.00
R7683:Arpc2 UTSW 1 74263814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATGCTGCATAGGTGGACTC -3'
(R):5'- TTGGAAGCCCCTGTTAGCTG -3'

Sequencing Primer
(F):5'- CTGCATAGGTGGACTCTTTAATAGC -3'
(R):5'- GCCCCTGTTAGCTGTATAAAGAAGC -3'
Posted On2016-06-21