Incidental Mutation 'R0449:Rad54b'
ID39503
Institutional Source Beutler Lab
Gene Symbol Rad54b
Ensembl Gene ENSMUSG00000078773
Gene NameRAD54 homolog B (S. cerevisiae)
SynonymsE130016E03Rik, E130016E03Rik
MMRRC Submission 038649-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0449 (G1)
Quality Score157
Status Not validated
Chromosome4
Chromosomal Location11558922-11615805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11606131 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 513 (I513N)
Ref Sequence ENSEMBL: ENSMUSP00000066977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070755]
Predicted Effect probably benign
Transcript: ENSMUST00000070755
AA Change: I513N

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066977
Gene: ENSMUSG00000078773
AA Change: I513N

DomainStartEndE-ValueType
low complexity region 113 121 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
DEXDc 270 470 4.36e-36 SMART
HELICc 652 736 6.14e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144499
Predicted Effect probably benign
Transcript: ENSMUST00000178725
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an increased sensitivity to ionizing radiation and other agents of DNA damage but outherwise have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,939,885 R813* probably null Het
Accsl T A 2: 93,866,074 I60F probably benign Het
Adam29 C T 8: 55,872,681 G246D probably benign Het
Ankrd13c A G 3: 157,991,714 I319V probably benign Het
B020004J07Rik T C 4: 101,836,961 S242G probably benign Het
Bag6 T G 17: 35,141,466 V327G probably damaging Het
Barhl1 C T 2: 28,915,292 A130T probably benign Het
Bend4 T C 5: 67,398,240 D541G probably damaging Het
Birc6 A C 17: 74,692,295 T4673P probably damaging Het
Ccdc81 T C 7: 89,890,471 R186G probably damaging Het
Cdyl2 A G 8: 116,583,192 F342L probably damaging Het
Chd3 C A 11: 69,357,541 V748L probably damaging Het
CN725425 G T 15: 91,238,944 R72I possibly damaging Het
Col22a1 A G 15: 71,962,671 probably null Het
Cops3 A G 11: 59,818,417 probably null Het
Ctnnd1 G T 2: 84,603,262 Q940K possibly damaging Het
Dtnb C T 12: 3,591,971 Q45* probably null Het
Efr3a T A 15: 65,842,704 I280K probably damaging Het
Eml6 A C 11: 29,893,213 V167G probably benign Het
Fam83c T A 2: 155,830,295 M407L probably benign Het
Fasn T C 11: 120,811,068 T1862A probably benign Het
Fbxl6 A G 15: 76,535,955 I486T probably damaging Het
Gpr182 A G 10: 127,750,696 Y129H probably damaging Het
Gpr75 A G 11: 30,892,456 S454G probably damaging Het
Hectd4 G A 5: 121,364,590 probably null Het
Hsf4 A G 8: 105,275,590 T411A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il4 A T 11: 53,618,605 M1K probably null Het
Ints11 G T 4: 155,887,948 R463L probably benign Het
Ints4 G A 7: 97,529,223 E677K probably damaging Het
Klk1b11 G A 7: 43,997,792 C50Y probably damaging Het
Krt14 C A 11: 100,207,395 G21C unknown Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lama3 A G 18: 12,500,512 probably null Het
Lrrk2 T C 15: 91,750,275 L1414P probably damaging Het
Matn2 T C 15: 34,428,541 S684P probably damaging Het
Mga T A 2: 119,941,381 V1574D probably damaging Het
Mia2 T C 12: 59,172,594 probably null Het
Mrpl21 T A 19: 3,292,459 probably benign Het
Msh5 T A 17: 35,041,482 Q266L probably benign Het
Mybpc1 C A 10: 88,540,960 C758F probably damaging Het
Myo15 G A 11: 60,509,596 A2932T possibly damaging Het
Nbas T A 12: 13,519,108 I2021K probably benign Het
Neurl4 T C 11: 69,905,567 S424P probably damaging Het
Olfr16 T A 1: 172,957,398 V201E probably damaging Het
Olfr322 A C 11: 58,665,963 I135L probably benign Het
Olfr782 A G 10: 129,351,234 M224V probably benign Het
Olfr829 T C 9: 18,856,649 M8T probably benign Het
Olfr850 T A 9: 19,478,092 I53F possibly damaging Het
Phlpp1 C T 1: 106,350,578 R907W probably damaging Het
Pigg T C 5: 108,336,411 V508A probably benign Het
Pkhd1l1 T G 15: 44,501,519 Y685D probably damaging Het
Polr3a A T 14: 24,484,466 I34N probably damaging Het
Prex1 A G 2: 166,569,377 V1434A probably benign Het
Ptprh T A 7: 4,598,006 D124V probably damaging Het
Rbm12b1 A G 4: 12,145,507 N493S probably benign Het
Rfx7 A T 9: 72,610,304 probably null Het
Serpini1 A G 3: 75,613,341 K82E probably benign Het
Slc27a6 T G 18: 58,609,165 probably null Het
Slc35f2 G T 9: 53,816,917 L358F probably damaging Het
Slc45a1 A C 4: 150,643,305 I158M probably damaging Het
Slurp2 G A 15: 74,743,106 P62L probably damaging Het
Sspo C T 6: 48,466,740 H1949Y probably damaging Het
Tiam1 A T 16: 89,837,827 V865E possibly damaging Het
Tlr4 A C 4: 66,839,620 I217L probably damaging Het
Top1 C T 2: 160,712,708 R460* probably null Het
Trpm3 T A 19: 22,988,054 S1638T probably benign Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Vars T G 17: 35,012,727 probably null Het
Xylt2 A G 11: 94,666,333 Y111H probably benign Het
Zbed5 G A 5: 129,901,726 G172D probably damaging Het
Zfp53 C T 17: 21,508,833 T376I probably benign Het
Zfp937 G T 2: 150,239,546 V499L probably benign Het
Zyx T A 6: 42,351,313 L152Q probably damaging Het
Other mutations in Rad54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Rad54b APN 4 11593765 missense probably benign
IGL00774:Rad54b APN 4 11593765 missense probably benign
IGL00956:Rad54b APN 4 11597833 missense probably damaging 0.98
IGL00961:Rad54b APN 4 11599699 missense probably damaging 1.00
IGL01064:Rad54b APN 4 11604866 missense probably damaging 1.00
IGL02150:Rad54b APN 4 11610502 missense probably damaging 1.00
IGL02326:Rad54b APN 4 11612713 missense probably damaging 1.00
IGL03105:Rad54b APN 4 11615569 missense probably benign 0.00
IGL03143:Rad54b APN 4 11599755 missense probably damaging 1.00
IGL03288:Rad54b APN 4 11569833 missense possibly damaging 0.83
kerplunk UTSW 4 11612655 missense probably damaging 1.00
Schnipfel UTSW 4 11583689 unclassified probably benign
P0033:Rad54b UTSW 4 11609285 unclassified probably benign
R0076:Rad54b UTSW 4 11609480 unclassified probably benign
R0094:Rad54b UTSW 4 11599681 missense possibly damaging 0.92
R0391:Rad54b UTSW 4 11601702 missense probably damaging 0.98
R0441:Rad54b UTSW 4 11563394 missense probably benign 0.08
R0442:Rad54b UTSW 4 11609480 unclassified probably benign
R0442:Rad54b UTSW 4 11610362 missense probably benign 0.02
R0519:Rad54b UTSW 4 11599809 missense probably damaging 1.00
R0843:Rad54b UTSW 4 11609471 critical splice donor site probably null
R1118:Rad54b UTSW 4 11563352 missense probably damaging 1.00
R1439:Rad54b UTSW 4 11606152 missense possibly damaging 0.90
R1763:Rad54b UTSW 4 11604989 missense possibly damaging 0.52
R1812:Rad54b UTSW 4 11612770 missense probably damaging 1.00
R1854:Rad54b UTSW 4 11601669 missense probably damaging 1.00
R1917:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R1918:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R1919:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R2057:Rad54b UTSW 4 11606088 missense probably benign 0.08
R2386:Rad54b UTSW 4 11597874 missense probably benign
R2437:Rad54b UTSW 4 11606272 missense probably damaging 1.00
R4299:Rad54b UTSW 4 11597865 missense probably damaging 1.00
R4391:Rad54b UTSW 4 11615570 missense probably benign 0.00
R4672:Rad54b UTSW 4 11609449 missense probably benign 0.05
R4673:Rad54b UTSW 4 11609449 missense probably benign 0.05
R4826:Rad54b UTSW 4 11599753 missense probably damaging 1.00
R4930:Rad54b UTSW 4 11615579 missense probably damaging 0.99
R5796:Rad54b UTSW 4 11615446 missense probably benign 0.01
R5901:Rad54b UTSW 4 11595919 missense possibly damaging 0.84
R6185:Rad54b UTSW 4 11593804 missense possibly damaging 0.51
R6355:Rad54b UTSW 4 11604989 missense possibly damaging 0.52
R6576:Rad54b UTSW 4 11601577 missense probably benign
R6684:Rad54b UTSW 4 11583689 unclassified probably benign
R6821:Rad54b UTSW 4 11612777 missense probably damaging 1.00
R6947:Rad54b UTSW 4 11569859 missense possibly damaging 0.83
R7177:Rad54b UTSW 4 11599755 missense probably damaging 1.00
R7361:Rad54b UTSW 4 11599782 missense probably damaging 1.00
R7483:Rad54b UTSW 4 11610372 missense probably damaging 1.00
R7511:Rad54b UTSW 4 11578956 splice site probably null
R7847:Rad54b UTSW 4 11612655 missense probably damaging 1.00
R7908:Rad54b UTSW 4 11595868 missense probably null 0.01
R8198:Rad54b UTSW 4 11612440 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ttcctatctcaTGCACCCCACACC -3'
(R):5'- CCTTCACAGAGCTGAACAAGAGGC -3'

Sequencing Primer
(F):5'- gaactgacccacccatatcc -3'
(R):5'- AGGGTGGTTGCACAGCTTC -3'
Posted On2013-05-23