Incidental Mutation 'R5144:4933409G03Rik'
ID395034
Institutional Source Beutler Lab
Gene Symbol 4933409G03Rik
Ensembl Gene ENSMUSG00000053896
Gene NameRIKEN cDNA 4933409G03 gene
Synonyms
MMRRC Submission 042728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5144 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location68582413-68616463 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 68616260 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000102713]
Predicted Effect unknown
Transcript: ENSMUST00000102713
AA Change: D294E
SMART Domains Protein: ENSMUSP00000099774
Gene: ENSMUSG00000053896
AA Change: D294E

DomainStartEndE-ValueType
low complexity region 74 86 N/A INTRINSIC
low complexity region 89 133 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137117
SMART Domains Protein: ENSMUSP00000117165
Gene: ENSMUSG00000053896

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
low complexity region 71 115 N/A INTRINSIC
low complexity region 176 188 N/A INTRINSIC
Meta Mutation Damage Score 0.0906 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik C A 15: 98,585,267 probably null Het
Arpc2 A T 1: 74,248,208 K62N probably damaging Het
B4galt5 C T 2: 167,306,596 E201K possibly damaging Het
Bub1b C T 2: 118,615,499 T334M possibly damaging Het
Ccdc71 T C 9: 108,463,852 V288A probably benign Het
Cep350 G A 1: 155,911,150 R1444W probably damaging Het
Chrna4 A G 2: 181,024,830 L605P probably damaging Het
Col6a5 T A 9: 105,889,283 I1813F probably damaging Het
Col9a1 A G 1: 24,239,353 I821V probably benign Het
D430041D05Rik T C 2: 104,258,502 D43G probably damaging Het
Depdc7 T C 2: 104,730,253 Y132C probably damaging Het
Dppa2 T C 16: 48,317,303 V216A probably damaging Het
Ect2l A T 10: 18,144,577 N598K probably benign Het
Eif3c T C 7: 126,563,066 T195A probably benign Het
Epg5 T C 18: 78,015,680 V1883A probably damaging Het
Ino80c T A 18: 24,108,878 D150V probably benign Het
Kcnb1 T A 2: 167,105,944 Y328F probably damaging Het
Kcnj3 G A 2: 55,447,047 probably null Het
Ncor1 T G 11: 62,349,464 S894R probably damaging Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Nudt19 T C 7: 35,555,225 T194A probably benign Het
Olfr350 A T 2: 36,850,144 T33S probably benign Het
Olfr920 C T 9: 38,756,393 S235L possibly damaging Het
Pappa2 T A 1: 158,957,133 R102S probably benign Het
Pik3c2a T C 7: 116,350,786 N1332S probably benign Het
Plppr1 T A 4: 49,319,800 V142E possibly damaging Het
Prdm6 C A 18: 53,465,038 probably benign Het
Prm2 T A 16: 10,791,868 probably benign Het
Prmt3 T C 7: 49,786,135 S155P possibly damaging Het
Rars2 T C 4: 34,656,793 Y481H probably benign Het
Rgs2 G A 1: 144,001,699 T206M probably benign Het
Slc2a8 C T 2: 32,981,773 R56H probably damaging Het
Stk35 T A 2: 129,810,935 M452K probably damaging Het
Tcf3 G A 10: 80,415,237 H454Y probably damaging Het
Tgm3 C T 2: 130,048,282 S655F possibly damaging Het
Tssc4 T G 7: 143,070,033 L26R probably damaging Het
Utp11 A T 4: 124,678,902 probably benign Het
Vmn1r237 C G 17: 21,314,426 A137G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T C 16: 21,559,353 L1038P probably damaging Het
Wipf3 C T 6: 54,485,675 A290V probably damaging Het
Zdhhc25 T G 15: 88,601,056 L198R probably damaging Het
Zdhhc6 A T 19: 55,314,566 M1K probably null Het
Other mutations in 4933409G03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:4933409G03Rik APN 2 68601898 missense unknown
IGL00514:4933409G03Rik APN 2 68601797 missense unknown
IGL02173:4933409G03Rik APN 2 68613057 missense unknown
IGL02252:4933409G03Rik APN 2 68614334 splice site probably benign
PIT4812001:4933409G03Rik UTSW 2 68588948 missense probably benign 0.16
R0196:4933409G03Rik UTSW 2 68616247 unclassified probably benign
R1939:4933409G03Rik UTSW 2 68588984 missense possibly damaging 0.83
R2422:4933409G03Rik UTSW 2 68591520 missense probably benign 0.16
R3435:4933409G03Rik UTSW 2 68601845 missense unknown
R4124:4933409G03Rik UTSW 2 68616224 unclassified probably benign
R4243:4933409G03Rik UTSW 2 68593543 intron probably benign
R4424:4933409G03Rik UTSW 2 68615147 unclassified probably benign
R4649:4933409G03Rik UTSW 2 68606215 missense unknown
R4650:4933409G03Rik UTSW 2 68606215 missense unknown
R4651:4933409G03Rik UTSW 2 68606215 missense unknown
R4652:4933409G03Rik UTSW 2 68606215 missense unknown
R4653:4933409G03Rik UTSW 2 68606215 missense unknown
R4732:4933409G03Rik UTSW 2 68614721 unclassified probably benign
R4733:4933409G03Rik UTSW 2 68614721 unclassified probably benign
R5499:4933409G03Rik UTSW 2 68601793 missense unknown
R5828:4933409G03Rik UTSW 2 68601800 missense unknown
R5936:4933409G03Rik UTSW 2 68615504 unclassified probably benign
R6323:4933409G03Rik UTSW 2 68606224 missense unknown
R7491:4933409G03Rik UTSW 2 68614755 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCAGCTTCTCACAGGATTGT -3'
(R):5'- ATATTTAAAAGAAGTGATGCTGGGAA -3'

Sequencing Primer
(F):5'- GGATTGTGCCTATAACTTGAAAGAC -3'
(R):5'- TTGGGAACATGCACACTG -3'
Posted On2016-06-21