Incidental Mutation 'R5144:Stk35'
ID 395038
Institutional Source Beutler Lab
Gene Symbol Stk35
Ensembl Gene ENSMUSG00000037885
Gene Name serine/threonine kinase 35
Synonyms 1700054C12Rik, CLIK1, CLP-36 interacting kinase
MMRRC Submission 042728-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5144 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 129800517-129832287 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129810935 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 452 (M452K)
Ref Sequence ENSEMBL: ENSMUSP00000126541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165413] [ENSMUST00000166282]
AlphaFold Q80ZW0
Predicted Effect probably damaging
Transcript: ENSMUST00000165413
AA Change: M452K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126541
Gene: ENSMUSG00000037885
AA Change: M452K

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 295 2e-6 PFAM
Pfam:Pkinase 207 531 8.6e-51 PFAM
Pfam:Pkinase_Tyr 304 532 2.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166282
SMART Domains Protein: ENSMUSP00000132862
Gene: ENSMUSG00000037885

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 300 5.9e-7 PFAM
Pfam:Pkinase 207 311 1e-9 PFAM
Meta Mutation Damage Score 0.9583 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik C A 15: 98,585,267 probably null Het
4933409G03Rik T A 2: 68,616,260 probably benign Het
Arpc2 A T 1: 74,248,208 K62N probably damaging Het
B4galt5 C T 2: 167,306,596 E201K possibly damaging Het
Bub1b C T 2: 118,615,499 T334M possibly damaging Het
Ccdc71 T C 9: 108,463,852 V288A probably benign Het
Cep350 G A 1: 155,911,150 R1444W probably damaging Het
Chrna4 A G 2: 181,024,830 L605P probably damaging Het
Col6a5 T A 9: 105,889,283 I1813F probably damaging Het
Col9a1 A G 1: 24,239,353 I821V probably benign Het
D430041D05Rik T C 2: 104,258,502 D43G probably damaging Het
Depdc7 T C 2: 104,730,253 Y132C probably damaging Het
Dppa2 T C 16: 48,317,303 V216A probably damaging Het
Ect2l A T 10: 18,144,577 N598K probably benign Het
Eif3c T C 7: 126,563,066 T195A probably benign Het
Epg5 T C 18: 78,015,680 V1883A probably damaging Het
Ino80c T A 18: 24,108,878 D150V probably benign Het
Kcnb1 T A 2: 167,105,944 Y328F probably damaging Het
Kcnj3 G A 2: 55,447,047 probably null Het
Ncor1 T G 11: 62,349,464 S894R probably damaging Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Nudt19 T C 7: 35,555,225 T194A probably benign Het
Olfr350 A T 2: 36,850,144 T33S probably benign Het
Olfr920 C T 9: 38,756,393 S235L possibly damaging Het
Pappa2 T A 1: 158,957,133 R102S probably benign Het
Pik3c2a T C 7: 116,350,786 N1332S probably benign Het
Plppr1 T A 4: 49,319,800 V142E possibly damaging Het
Prdm6 C A 18: 53,465,038 probably benign Het
Prm2 T A 16: 10,791,868 probably benign Het
Prmt3 T C 7: 49,786,135 S155P possibly damaging Het
Rars2 T C 4: 34,656,793 Y481H probably benign Het
Rgs2 G A 1: 144,001,699 T206M probably benign Het
Slc2a8 C T 2: 32,981,773 R56H probably damaging Het
Tcf3 G A 10: 80,415,237 H454Y probably damaging Het
Tgm3 C T 2: 130,048,282 S655F possibly damaging Het
Tssc4 T G 7: 143,070,033 L26R probably damaging Het
Utp11 A T 4: 124,678,902 probably benign Het
Vmn1r237 C G 17: 21,314,426 A137G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T C 16: 21,559,353 L1038P probably damaging Het
Wipf3 C T 6: 54,485,675 A290V probably damaging Het
Zdhhc25 T G 15: 88,601,056 L198R probably damaging Het
Zdhhc6 A T 19: 55,314,566 M1K probably null Het
Other mutations in Stk35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Stk35 APN 2 129801992 missense probably damaging 1.00
IGL02609:Stk35 APN 2 129801801 missense probably damaging 1.00
fingernails UTSW 2 129810935 missense probably damaging 1.00
R2256_Stk35_331 UTSW 2 129810507 nonsense probably null
skinned UTSW 2 129811235 intron probably benign
R0045:Stk35 UTSW 2 129800568 nonsense probably null
R0306:Stk35 UTSW 2 129801763 nonsense probably null
R0784:Stk35 UTSW 2 129810802 nonsense probably null
R1536:Stk35 UTSW 2 129811235 intron probably benign
R2256:Stk35 UTSW 2 129810507 nonsense probably null
R2507:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R2508:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R3848:Stk35 UTSW 2 129800736 missense probably benign 0.13
R3872:Stk35 UTSW 2 129810575 missense possibly damaging 0.82
R4466:Stk35 UTSW 2 129801516 missense probably damaging 0.99
R6267:Stk35 UTSW 2 129810888 nonsense probably null
R6296:Stk35 UTSW 2 129810888 nonsense probably null
R6480:Stk35 UTSW 2 129810687 missense possibly damaging 0.95
R6807:Stk35 UTSW 2 129801653 missense probably damaging 0.97
R7203:Stk35 UTSW 2 129801593 missense probably benign
R7476:Stk35 UTSW 2 129810725 missense probably damaging 1.00
R8505:Stk35 UTSW 2 129801729 missense probably damaging 0.99
R8998:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R8999:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R9224:Stk35 UTSW 2 129810571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGACTTTGGACTGAGC -3'
(R):5'- GCAGCTAACATGTCTTTCAAGAGC -3'

Sequencing Primer
(F):5'- ACTTTGGACTGAGCAAGGTC -3'
(R):5'- AAGAGCTGCTTGACCCCCTC -3'
Posted On 2016-06-21