Mutagenetix > Incidental Mutations

Incidental Mutation 'R5144:Stk35'

395038

Institutional Source

Beutler Lab

Gene Symbol

Stk35

Ensembl Gene

ENSMUSG00000037885

Gene Name

serine/threonine kinase 35

Synonyms

1700054C12Rik, CLIK1, CLP-36 interacting kinase

MMRRC Submission

042728-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5144 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129800517-129832287 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 129810935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 452 (M452K)

Ref Sequence

ENSEMBL: ENSMUSP00000126541 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165413] [ENSMUST00000166282]

AlphaFold

Q80ZW0

Predicted Effect

probably damaging
Transcript: ENSMUST00000165413
AA Change: M452K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126541
Gene: ENSMUSG00000037885
AA Change: M452K

Domain	Start	End	E-Value	Type
low complexity region	51	69	N/A	INTRINSIC
low complexity region	115	137	N/A	INTRINSIC
low complexity region	190	206	N/A	INTRINSIC
Pfam:Pkinase_Tyr	207	295	2e-6	PFAM
Pfam:Pkinase	207	531	8.6e-51	PFAM
Pfam:Pkinase_Tyr	304	532	2.1e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166282

SMART Domains

Protein: ENSMUSP00000132862
Gene: ENSMUSG00000037885

Domain	Start	End	E-Value	Type
low complexity region	51	69	N/A	INTRINSIC
low complexity region	115	137	N/A	INTRINSIC
low complexity region	190	206	N/A	INTRINSIC
Pfam:Pkinase_Tyr	207	300	5.9e-7	PFAM
Pfam:Pkinase	207	311	1e-9	PFAM

Meta Mutation Damage Score

0.9583

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415O20Rik	C	A	15: 98,585,267		probably null	Het
4933409G03Rik	T	A	2: 68,616,260		probably benign	Het
Arpc2	A	T	1: 74,248,208	K62N	probably damaging	Het
B4galt5	C	T	2: 167,306,596	E201K	possibly damaging	Het
Bub1b	C	T	2: 118,615,499	T334M	possibly damaging	Het
Ccdc71	T	C	9: 108,463,852	V288A	probably benign	Het
Cep350	G	A	1: 155,911,150	R1444W	probably damaging	Het
Chrna4	A	G	2: 181,024,830	L605P	probably damaging	Het
Col6a5	T	A	9: 105,889,283	I1813F	probably damaging	Het
Col9a1	A	G	1: 24,239,353	I821V	probably benign	Het
D430041D05Rik	T	C	2: 104,258,502	D43G	probably damaging	Het
Depdc7	T	C	2: 104,730,253	Y132C	probably damaging	Het
Dppa2	T	C	16: 48,317,303	V216A	probably damaging	Het
Ect2l	A	T	10: 18,144,577	N598K	probably benign	Het
Eif3c	T	C	7: 126,563,066	T195A	probably benign	Het
Epg5	T	C	18: 78,015,680	V1883A	probably damaging	Het
Ino80c	T	A	18: 24,108,878	D150V	probably benign	Het
Kcnb1	T	A	2: 167,105,944	Y328F	probably damaging	Het
Kcnj3	G	A	2: 55,447,047		probably null	Het
Ncor1	T	G	11: 62,349,464	S894R	probably damaging	Het
Nlgn3	G	A	X: 101,318,285	V287I	probably benign	Het
Nod2	T	C	8: 88,653,066	V72A	probably damaging	Het
Nudt19	T	C	7: 35,555,225	T194A	probably benign	Het
Olfr350	A	T	2: 36,850,144	T33S	probably benign	Het
Olfr920	C	T	9: 38,756,393	S235L	possibly damaging	Het
Pappa2	T	A	1: 158,957,133	R102S	probably benign	Het
Pik3c2a	T	C	7: 116,350,786	N1332S	probably benign	Het
Plppr1	T	A	4: 49,319,800	V142E	possibly damaging	Het
Prdm6	C	A	18: 53,465,038		probably benign	Het
Prm2	T	A	16: 10,791,868		probably benign	Het
Prmt3	T	C	7: 49,786,135	S155P	possibly damaging	Het
Rars2	T	C	4: 34,656,793	Y481H	probably benign	Het
Rgs2	G	A	1: 144,001,699	T206M	probably benign	Het
Slc2a8	C	T	2: 32,981,773	R56H	probably damaging	Het
Tcf3	G	A	10: 80,415,237	H454Y	probably damaging	Het
Tgm3	C	T	2: 130,048,282	S655F	possibly damaging	Het
Tssc4	T	G	7: 143,070,033	L26R	probably damaging	Het
Utp11	A	T	4: 124,678,902		probably benign	Het
Vmn1r237	C	G	17: 21,314,426	A137G	possibly damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps8	T	C	16: 21,559,353	L1038P	probably damaging	Het
Wipf3	C	T	6: 54,485,675	A290V	probably damaging	Het
Zdhhc25	T	G	15: 88,601,056	L198R	probably damaging	Het
Zdhhc6	A	T	19: 55,314,566	M1K	probably null	Het

Other mutations in Stk35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Stk35	APN	2	129801992	missense	probably damaging	1.00
IGL02609:Stk35	APN	2	129801801	missense	probably damaging	1.00
fingernails	UTSW	2	129810935	missense	probably damaging	1.00
R2256_Stk35_331	UTSW	2	129810507	nonsense	probably null
skinned	UTSW	2	129811235	intron	probably benign
R0045:Stk35	UTSW	2	129800568	nonsense	probably null
R0306:Stk35	UTSW	2	129801763	nonsense	probably null
R0784:Stk35	UTSW	2	129810802	nonsense	probably null
R1536:Stk35	UTSW	2	129811235	intron	probably benign
R2256:Stk35	UTSW	2	129810507	nonsense	probably null
R2507:Stk35	UTSW	2	129801515	missense	probably damaging	0.97
R2508:Stk35	UTSW	2	129801515	missense	probably damaging	0.97
R3848:Stk35	UTSW	2	129800736	missense	probably benign	0.13
R3872:Stk35	UTSW	2	129810575	missense	possibly damaging	0.82
R4466:Stk35	UTSW	2	129801516	missense	probably damaging	0.99
R6267:Stk35	UTSW	2	129810888	nonsense	probably null
R6296:Stk35	UTSW	2	129810888	nonsense	probably null
R6480:Stk35	UTSW	2	129810687	missense	possibly damaging	0.95
R6807:Stk35	UTSW	2	129801653	missense	probably damaging	0.97
R7203:Stk35	UTSW	2	129801593	missense	probably benign
R7476:Stk35	UTSW	2	129810725	missense	probably damaging	1.00
R8505:Stk35	UTSW	2	129801729	missense	probably damaging	0.99
R8998:Stk35	UTSW	2	129810589	missense	probably damaging	1.00
R8999:Stk35	UTSW	2	129810589	missense	probably damaging	1.00
R9224:Stk35	UTSW	2	129810571	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCAGACTTTGGACTGAGC -3'
(R):5'- GCAGCTAACATGTCTTTCAAGAGC -3'

Sequencing Primer
(F):5'- ACTTTGGACTGAGCAAGGTC -3'
(R):5'- AAGAGCTGCTTGACCCCCTC -3'

Posted On

2016-06-21