Incidental Mutation 'R5144:Tgm3'
ID395039
Institutional Source Beutler Lab
Gene Symbol Tgm3
Ensembl Gene ENSMUSG00000027401
Gene Nametransglutaminase 3, E polypeptide
SynonymsTG E
MMRRC Submission 042728-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5144 (G1)
Quality Score197
Status Validated
Chromosome2
Chromosomal Location130012349-130050399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130048282 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 655 (S655F)
Ref Sequence ENSEMBL: ENSMUSP00000105928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110299
AA Change: S655F

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: S655F

DomainStartEndE-ValueType
Pfam:Transglut_N 5 118 8.3e-33 PFAM
TGc 265 357 6.4e-39 SMART
Pfam:Transglut_C 483 588 3.9e-26 PFAM
Pfam:Transglut_C 595 693 4.9e-24 PFAM
Meta Mutation Damage Score 0.2476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik C A 15: 98,585,267 probably null Het
4933409G03Rik T A 2: 68,616,260 probably benign Het
Arpc2 A T 1: 74,248,208 K62N probably damaging Het
B4galt5 C T 2: 167,306,596 E201K possibly damaging Het
Bub1b C T 2: 118,615,499 T334M possibly damaging Het
Ccdc71 T C 9: 108,463,852 V288A probably benign Het
Cep350 G A 1: 155,911,150 R1444W probably damaging Het
Chrna4 A G 2: 181,024,830 L605P probably damaging Het
Col6a5 T A 9: 105,889,283 I1813F probably damaging Het
Col9a1 A G 1: 24,239,353 I821V probably benign Het
D430041D05Rik T C 2: 104,258,502 D43G probably damaging Het
Depdc7 T C 2: 104,730,253 Y132C probably damaging Het
Dppa2 T C 16: 48,317,303 V216A probably damaging Het
Ect2l A T 10: 18,144,577 N598K probably benign Het
Eif3c T C 7: 126,563,066 T195A probably benign Het
Epg5 T C 18: 78,015,680 V1883A probably damaging Het
Ino80c T A 18: 24,108,878 D150V probably benign Het
Kcnb1 T A 2: 167,105,944 Y328F probably damaging Het
Kcnj3 G A 2: 55,447,047 probably null Het
Ncor1 T G 11: 62,349,464 S894R probably damaging Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Nudt19 T C 7: 35,555,225 T194A probably benign Het
Olfr350 A T 2: 36,850,144 T33S probably benign Het
Olfr920 C T 9: 38,756,393 S235L possibly damaging Het
Pappa2 T A 1: 158,957,133 R102S probably benign Het
Pik3c2a T C 7: 116,350,786 N1332S probably benign Het
Plppr1 T A 4: 49,319,800 V142E possibly damaging Het
Prdm6 C A 18: 53,465,038 probably benign Het
Prm2 T A 16: 10,791,868 probably benign Het
Prmt3 T C 7: 49,786,135 S155P possibly damaging Het
Rars2 T C 4: 34,656,793 Y481H probably benign Het
Rgs2 G A 1: 144,001,699 T206M probably benign Het
Slc2a8 C T 2: 32,981,773 R56H probably damaging Het
Stk35 T A 2: 129,810,935 M452K probably damaging Het
Tcf3 G A 10: 80,415,237 H454Y probably damaging Het
Tssc4 T G 7: 143,070,033 L26R probably damaging Het
Utp11 A T 4: 124,678,902 probably benign Het
Vmn1r237 C G 17: 21,314,426 A137G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T C 16: 21,559,353 L1038P probably damaging Het
Wipf3 C T 6: 54,485,675 A290V probably damaging Het
Zdhhc25 T G 15: 88,601,056 L198R probably damaging Het
Zdhhc6 A T 19: 55,314,566 M1K probably null Het
Other mutations in Tgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Tgm3 APN 2 130038413 missense probably damaging 1.00
IGL00924:Tgm3 APN 2 130038374 missense probably damaging 1.00
IGL01469:Tgm3 APN 2 130024494 missense probably damaging 1.00
IGL01722:Tgm3 APN 2 130044568 missense probably damaging 0.99
IGL01787:Tgm3 APN 2 130047740 missense possibly damaging 0.85
IGL02269:Tgm3 APN 2 130024518 missense probably benign 0.02
IGL02437:Tgm3 APN 2 130030041 splice site probably null
IGL02449:Tgm3 APN 2 130038609 critical splice donor site probably null
IGL02992:Tgm3 APN 2 130041979 missense probably damaging 1.00
tortellini UTSW 2 130024585 critical splice donor site probably benign
ANU74:Tgm3 UTSW 2 130048390 missense probably damaging 1.00
R0523:Tgm3 UTSW 2 130044662 critical splice donor site probably null
R0833:Tgm3 UTSW 2 130026682 splice site probably benign
R0834:Tgm3 UTSW 2 130026757 missense probably benign 0.00
R0836:Tgm3 UTSW 2 130026682 splice site probably benign
R0940:Tgm3 UTSW 2 130012406 missense probably benign 0.00
R1354:Tgm3 UTSW 2 130041898 missense probably benign
R1642:Tgm3 UTSW 2 130047782 missense probably damaging 1.00
R1670:Tgm3 UTSW 2 130041768 nonsense probably null
R1715:Tgm3 UTSW 2 130026814 critical splice donor site probably null
R1944:Tgm3 UTSW 2 130029969 missense probably damaging 0.99
R2104:Tgm3 UTSW 2 130037483 missense probably benign 0.39
R3416:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R3417:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R4231:Tgm3 UTSW 2 130044589 nonsense probably null
R4296:Tgm3 UTSW 2 130038413 missense possibly damaging 0.77
R4794:Tgm3 UTSW 2 130041955 missense probably benign 0.00
R4948:Tgm3 UTSW 2 130048320 missense probably benign 0.00
R5034:Tgm3 UTSW 2 130037484 missense possibly damaging 0.95
R5786:Tgm3 UTSW 2 130026784 nonsense probably null
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6182:Tgm3 UTSW 2 130025301 nonsense probably null
R6219:Tgm3 UTSW 2 130038610 critical splice donor site probably null
R6901:Tgm3 UTSW 2 130041970 missense possibly damaging 0.95
R6969:Tgm3 UTSW 2 130042029 missense probably benign 0.06
R6980:Tgm3 UTSW 2 130026777 missense probably benign 0.17
R7282:Tgm3 UTSW 2 130024561 missense probably benign 0.00
R7317:Tgm3 UTSW 2 130048291 missense probably benign 0.09
R7513:Tgm3 UTSW 2 130024404 missense probably benign 0.00
R7517:Tgm3 UTSW 2 130041764 missense probably benign 0.01
R7793:Tgm3 UTSW 2 130012410 critical splice donor site probably null
R7822:Tgm3 UTSW 2 130041899 missense probably benign 0.00
R7955:Tgm3 UTSW 2 130038480 missense probably benign
X0065:Tgm3 UTSW 2 130024510 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCTGGCTGTCACAGAGTCAAAG -3'
(R):5'- GCAACAGTTTCACTCCACAG -3'

Sequencing Primer
(F):5'- CTGTCACAGAGTCAAAGGGAACC -3'
(R):5'- ACAGGAGAGCGCTGTCTG -3'
Posted On2016-06-21