Mutagenetix > Incidental Mutations

Incidental Mutation 'R5144:Kcnb1'

395040

Institutional Source

Beutler Lab

Gene Symbol

Kcnb1

Ensembl Gene

ENSMUSG00000050556

Gene Name

potassium voltage gated channel, Shab-related subfamily, member 1

Synonyms

Kcr1-1, Shab, Kv2.1

MMRRC Submission

042728-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5144 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

167095969-167190155 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 167105944 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 328 (Y328F)

Ref Sequence

ENSEMBL: ENSMUSP00000147093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059826] [ENSMUST00000207917]

Predicted Effect

probably damaging
Transcript: ENSMUST00000059826
AA Change: Y328F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057981
Gene: ENSMUSG00000050556
AA Change: Y328F

Domain	Start	End	E-Value	Type
BTB	31	140	1.3e-14	SMART
low complexity region	150	162	N/A	INTRINSIC
Pfam:Ion_trans	188	424	2.4e-50	PFAM
Pfam:Ion_trans_2	332	418	1.2e-13	PFAM
Pfam:Kv2channel	467	618	5.4e-48	PFAM
low complexity region	698	706	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144351

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148226

Predicted Effect

probably damaging
Transcript: ENSMUST00000207917
AA Change: Y328F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.5854

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel and its activity is modulated by some other family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show reduced fasting glucose levels, hyperinsulinemia, improved glucose tolerance, altered glucose-induced electrical activity of pancreatic beta cells, and enhanced insulin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415O20Rik	C	A	15: 98,585,267		probably null	Het
4933409G03Rik	T	A	2: 68,616,260		probably benign	Het
Arpc2	A	T	1: 74,248,208	K62N	probably damaging	Het
B4galt5	C	T	2: 167,306,596	E201K	possibly damaging	Het
Bub1b	C	T	2: 118,615,499	T334M	possibly damaging	Het
Ccdc71	T	C	9: 108,463,852	V288A	probably benign	Het
Cep350	G	A	1: 155,911,150	R1444W	probably damaging	Het
Chrna4	A	G	2: 181,024,830	L605P	probably damaging	Het
Col6a5	T	A	9: 105,889,283	I1813F	probably damaging	Het
Col9a1	A	G	1: 24,239,353	I821V	probably benign	Het
D430041D05Rik	T	C	2: 104,258,502	D43G	probably damaging	Het
Depdc7	T	C	2: 104,730,253	Y132C	probably damaging	Het
Dppa2	T	C	16: 48,317,303	V216A	probably damaging	Het
Ect2l	A	T	10: 18,144,577	N598K	probably benign	Het
Eif3c	T	C	7: 126,563,066	T195A	probably benign	Het
Epg5	T	C	18: 78,015,680	V1883A	probably damaging	Het
Ino80c	T	A	18: 24,108,878	D150V	probably benign	Het
Kcnj3	G	A	2: 55,447,047		probably null	Het
Ncor1	T	G	11: 62,349,464	S894R	probably damaging	Het
Nlgn3	G	A	X: 101,318,285	V287I	probably benign	Het
Nod2	T	C	8: 88,653,066	V72A	probably damaging	Het
Nudt19	T	C	7: 35,555,225	T194A	probably benign	Het
Olfr350	A	T	2: 36,850,144	T33S	probably benign	Het
Olfr920	C	T	9: 38,756,393	S235L	possibly damaging	Het
Pappa2	T	A	1: 158,957,133	R102S	probably benign	Het
Pik3c2a	T	C	7: 116,350,786	N1332S	probably benign	Het
Plppr1	T	A	4: 49,319,800	V142E	possibly damaging	Het
Prdm6	C	A	18: 53,465,038		probably benign	Het
Prm2	T	A	16: 10,791,868		probably benign	Het
Prmt3	T	C	7: 49,786,135	S155P	possibly damaging	Het
Rars2	T	C	4: 34,656,793	Y481H	probably benign	Het
Rgs2	G	A	1: 144,001,699	T206M	probably benign	Het
Slc2a8	C	T	2: 32,981,773	R56H	probably damaging	Het
Stk35	T	A	2: 129,810,935	M452K	probably damaging	Het
Tcf3	G	A	10: 80,415,237	H454Y	probably damaging	Het
Tgm3	C	T	2: 130,048,282	S655F	possibly damaging	Het
Tssc4	T	G	7: 143,070,033	L26R	probably damaging	Het
Utp11	A	T	4: 124,678,902		probably benign	Het
Vmn1r237	C	G	17: 21,314,426	A137G	possibly damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps8	T	C	16: 21,559,353	L1038P	probably damaging	Het
Wipf3	C	T	6: 54,485,675	A290V	probably damaging	Het
Zdhhc25	T	G	15: 88,601,056	L198R	probably damaging	Het
Zdhhc6	A	T	19: 55,314,566	M1K	probably null	Het

Other mutations in Kcnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01593:Kcnb1	APN	2	167106207	missense	probably damaging	1.00
IGL02945:Kcnb1	APN	2	167188388	missense	probably benign	0.03
R0139:Kcnb1	UTSW	2	167105539	missense	possibly damaging	0.94
R0144:Kcnb1	UTSW	2	167104547	missense	probably damaging	1.00
R0238:Kcnb1	UTSW	2	167104969	missense	probably benign	0.04
R0238:Kcnb1	UTSW	2	167104969	missense	probably benign	0.04
R0848:Kcnb1	UTSW	2	167106267	missense	probably damaging	1.00
R2869:Kcnb1	UTSW	2	167105935	missense	probably damaging	1.00
R2869:Kcnb1	UTSW	2	167105935	missense	probably damaging	1.00
R3964:Kcnb1	UTSW	2	167104492	missense	probably damaging	1.00
R3966:Kcnb1	UTSW	2	167104492	missense	probably damaging	1.00
R4254:Kcnb1	UTSW	2	167105731	missense	probably damaging	1.00
R4418:Kcnb1	UTSW	2	167105675	nonsense	probably null
R4625:Kcnb1	UTSW	2	167188233	missense	probably damaging	1.00
R4949:Kcnb1	UTSW	2	167105601	missense	probably damaging	1.00
R5249:Kcnb1	UTSW	2	167105183	missense	possibly damaging	0.95
R5849:Kcnb1	UTSW	2	167106026	missense	probably damaging	1.00
R5869:Kcnb1	UTSW	2	167188071	missense	probably benign	0.01
R6108:Kcnb1	UTSW	2	167105140	missense	probably damaging	1.00
R6636:Kcnb1	UTSW	2	167105854	missense	probably damaging	0.99
R6637:Kcnb1	UTSW	2	167105854	missense	probably damaging	0.99
R6880:Kcnb1	UTSW	2	167105807	missense	probably damaging	1.00
R7391:Kcnb1	UTSW	2	167105450	missense	probably damaging	1.00
R7401:Kcnb1	UTSW	2	167188284	missense	probably damaging	0.99
R7651:Kcnb1	UTSW	2	167188361	missense	probably damaging	1.00
R7744:Kcnb1	UTSW	2	167188331	missense	probably damaging	1.00
R7825:Kcnb1	UTSW	2	167105972	missense	probably damaging	1.00
Z1088:Kcnb1	UTSW	2	167188061	missense	probably benign	0.38

Predicted Primers

PCR Primer
(F):5'- GAGAGTCTTAGGGTAGATGTCTCC -3'
(R):5'- TGGAAGTTCTTTAAGGGCCCC -3'

Sequencing Primer
(F):5'- TAGGGTAGATGTCTCCGTAACCAAC -3'
(R):5'- AACGCCATTGACTTACTGGC -3'

Posted On

2016-06-21