Incidental Mutation 'R5144:Kcnb1'
ID395040
Institutional Source Beutler Lab
Gene Symbol Kcnb1
Ensembl Gene ENSMUSG00000050556
Gene Namepotassium voltage gated channel, Shab-related subfamily, member 1
SynonymsKcr1-1, Shab, Kv2.1
MMRRC Submission 042728-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5144 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167095969-167190155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 167105944 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 328 (Y328F)
Ref Sequence ENSEMBL: ENSMUSP00000147093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059826] [ENSMUST00000207917]
Predicted Effect probably damaging
Transcript: ENSMUST00000059826
AA Change: Y328F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057981
Gene: ENSMUSG00000050556
AA Change: Y328F

DomainStartEndE-ValueType
BTB 31 140 1.3e-14 SMART
low complexity region 150 162 N/A INTRINSIC
Pfam:Ion_trans 188 424 2.4e-50 PFAM
Pfam:Ion_trans_2 332 418 1.2e-13 PFAM
Pfam:Kv2channel 467 618 5.4e-48 PFAM
low complexity region 698 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148226
Predicted Effect probably damaging
Transcript: ENSMUST00000207917
AA Change: Y328F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5854 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel and its activity is modulated by some other family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show reduced fasting glucose levels, hyperinsulinemia, improved glucose tolerance, altered glucose-induced electrical activity of pancreatic beta cells, and enhanced insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik C A 15: 98,585,267 probably null Het
4933409G03Rik T A 2: 68,616,260 probably benign Het
Arpc2 A T 1: 74,248,208 K62N probably damaging Het
B4galt5 C T 2: 167,306,596 E201K possibly damaging Het
Bub1b C T 2: 118,615,499 T334M possibly damaging Het
Ccdc71 T C 9: 108,463,852 V288A probably benign Het
Cep350 G A 1: 155,911,150 R1444W probably damaging Het
Chrna4 A G 2: 181,024,830 L605P probably damaging Het
Col6a5 T A 9: 105,889,283 I1813F probably damaging Het
Col9a1 A G 1: 24,239,353 I821V probably benign Het
D430041D05Rik T C 2: 104,258,502 D43G probably damaging Het
Depdc7 T C 2: 104,730,253 Y132C probably damaging Het
Dppa2 T C 16: 48,317,303 V216A probably damaging Het
Ect2l A T 10: 18,144,577 N598K probably benign Het
Eif3c T C 7: 126,563,066 T195A probably benign Het
Epg5 T C 18: 78,015,680 V1883A probably damaging Het
Ino80c T A 18: 24,108,878 D150V probably benign Het
Kcnj3 G A 2: 55,447,047 probably null Het
Ncor1 T G 11: 62,349,464 S894R probably damaging Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Nudt19 T C 7: 35,555,225 T194A probably benign Het
Olfr350 A T 2: 36,850,144 T33S probably benign Het
Olfr920 C T 9: 38,756,393 S235L possibly damaging Het
Pappa2 T A 1: 158,957,133 R102S probably benign Het
Pik3c2a T C 7: 116,350,786 N1332S probably benign Het
Plppr1 T A 4: 49,319,800 V142E possibly damaging Het
Prdm6 C A 18: 53,465,038 probably benign Het
Prm2 T A 16: 10,791,868 probably benign Het
Prmt3 T C 7: 49,786,135 S155P possibly damaging Het
Rars2 T C 4: 34,656,793 Y481H probably benign Het
Rgs2 G A 1: 144,001,699 T206M probably benign Het
Slc2a8 C T 2: 32,981,773 R56H probably damaging Het
Stk35 T A 2: 129,810,935 M452K probably damaging Het
Tcf3 G A 10: 80,415,237 H454Y probably damaging Het
Tgm3 C T 2: 130,048,282 S655F possibly damaging Het
Tssc4 T G 7: 143,070,033 L26R probably damaging Het
Utp11 A T 4: 124,678,902 probably benign Het
Vmn1r237 C G 17: 21,314,426 A137G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T C 16: 21,559,353 L1038P probably damaging Het
Wipf3 C T 6: 54,485,675 A290V probably damaging Het
Zdhhc25 T G 15: 88,601,056 L198R probably damaging Het
Zdhhc6 A T 19: 55,314,566 M1K probably null Het
Other mutations in Kcnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Kcnb1 APN 2 167106207 missense probably damaging 1.00
IGL02945:Kcnb1 APN 2 167188388 missense probably benign 0.03
R0139:Kcnb1 UTSW 2 167105539 missense possibly damaging 0.94
R0144:Kcnb1 UTSW 2 167104547 missense probably damaging 1.00
R0238:Kcnb1 UTSW 2 167104969 missense probably benign 0.04
R0238:Kcnb1 UTSW 2 167104969 missense probably benign 0.04
R0848:Kcnb1 UTSW 2 167106267 missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 167105935 missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 167105935 missense probably damaging 1.00
R3964:Kcnb1 UTSW 2 167104492 missense probably damaging 1.00
R3966:Kcnb1 UTSW 2 167104492 missense probably damaging 1.00
R4254:Kcnb1 UTSW 2 167105731 missense probably damaging 1.00
R4418:Kcnb1 UTSW 2 167105675 nonsense probably null
R4625:Kcnb1 UTSW 2 167188233 missense probably damaging 1.00
R4949:Kcnb1 UTSW 2 167105601 missense probably damaging 1.00
R5249:Kcnb1 UTSW 2 167105183 missense possibly damaging 0.95
R5849:Kcnb1 UTSW 2 167106026 missense probably damaging 1.00
R5869:Kcnb1 UTSW 2 167188071 missense probably benign 0.01
R6108:Kcnb1 UTSW 2 167105140 missense probably damaging 1.00
R6636:Kcnb1 UTSW 2 167105854 missense probably damaging 0.99
R6637:Kcnb1 UTSW 2 167105854 missense probably damaging 0.99
R6880:Kcnb1 UTSW 2 167105807 missense probably damaging 1.00
R7391:Kcnb1 UTSW 2 167105450 missense probably damaging 1.00
R7401:Kcnb1 UTSW 2 167188284 missense probably damaging 0.99
R7651:Kcnb1 UTSW 2 167188361 missense probably damaging 1.00
R7744:Kcnb1 UTSW 2 167188331 missense probably damaging 1.00
R7825:Kcnb1 UTSW 2 167105972 missense probably damaging 1.00
Z1088:Kcnb1 UTSW 2 167188061 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GAGAGTCTTAGGGTAGATGTCTCC -3'
(R):5'- TGGAAGTTCTTTAAGGGCCCC -3'

Sequencing Primer
(F):5'- TAGGGTAGATGTCTCCGTAACCAAC -3'
(R):5'- AACGCCATTGACTTACTGGC -3'
Posted On2016-06-21