Incidental Mutation 'R5144:Plppr1'
ID395043
Institutional Source Beutler Lab
Gene Symbol Plppr1
Ensembl Gene ENSMUSG00000063446
Gene Namephospholipid phosphatase related 1
SynonymsPRG-3, E130309F12Rik, Lppr1
MMRRC Submission 042728-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5144 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location49059273-49340259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49319800 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 142 (V142E)
Ref Sequence ENSEMBL: ENSMUSP00000075966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076670]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076670
AA Change: V142E

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075966
Gene: ENSMUSG00000063446
AA Change: V142E

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 128 272 4.47e-16 SMART
Meta Mutation Damage Score 0.6343 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plasticity-related gene (PRG) family. Members of the PRG family mediate lipid phosphate phosphatase activity in neurons and are known to be involved in neuronal plasticity. The protein encoded by this gene does not perform its function through enzymatic phospholipid degradation. This gene is strongly expressed in brain. It shows dynamic expression regulation during brain development and neuronal excitation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik C A 15: 98,585,267 probably null Het
4933409G03Rik T A 2: 68,616,260 probably benign Het
Arpc2 A T 1: 74,248,208 K62N probably damaging Het
B4galt5 C T 2: 167,306,596 E201K possibly damaging Het
Bub1b C T 2: 118,615,499 T334M possibly damaging Het
Ccdc71 T C 9: 108,463,852 V288A probably benign Het
Cep350 G A 1: 155,911,150 R1444W probably damaging Het
Chrna4 A G 2: 181,024,830 L605P probably damaging Het
Col6a5 T A 9: 105,889,283 I1813F probably damaging Het
Col9a1 A G 1: 24,239,353 I821V probably benign Het
D430041D05Rik T C 2: 104,258,502 D43G probably damaging Het
Depdc7 T C 2: 104,730,253 Y132C probably damaging Het
Dppa2 T C 16: 48,317,303 V216A probably damaging Het
Ect2l A T 10: 18,144,577 N598K probably benign Het
Eif3c T C 7: 126,563,066 T195A probably benign Het
Epg5 T C 18: 78,015,680 V1883A probably damaging Het
Ino80c T A 18: 24,108,878 D150V probably benign Het
Kcnb1 T A 2: 167,105,944 Y328F probably damaging Het
Kcnj3 G A 2: 55,447,047 probably null Het
Ncor1 T G 11: 62,349,464 S894R probably damaging Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Nudt19 T C 7: 35,555,225 T194A probably benign Het
Olfr350 A T 2: 36,850,144 T33S probably benign Het
Olfr920 C T 9: 38,756,393 S235L possibly damaging Het
Pappa2 T A 1: 158,957,133 R102S probably benign Het
Pik3c2a T C 7: 116,350,786 N1332S probably benign Het
Prdm6 C A 18: 53,465,038 probably benign Het
Prm2 T A 16: 10,791,868 probably benign Het
Prmt3 T C 7: 49,786,135 S155P possibly damaging Het
Rars2 T C 4: 34,656,793 Y481H probably benign Het
Rgs2 G A 1: 144,001,699 T206M probably benign Het
Slc2a8 C T 2: 32,981,773 R56H probably damaging Het
Stk35 T A 2: 129,810,935 M452K probably damaging Het
Tcf3 G A 10: 80,415,237 H454Y probably damaging Het
Tgm3 C T 2: 130,048,282 S655F possibly damaging Het
Tssc4 T G 7: 143,070,033 L26R probably damaging Het
Utp11 A T 4: 124,678,902 probably benign Het
Vmn1r237 C G 17: 21,314,426 A137G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T C 16: 21,559,353 L1038P probably damaging Het
Wipf3 C T 6: 54,485,675 A290V probably damaging Het
Zdhhc25 T G 15: 88,601,056 L198R probably damaging Het
Zdhhc6 A T 19: 55,314,566 M1K probably null Het
Other mutations in Plppr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Plppr1 APN 4 49319992 missense possibly damaging 0.88
PIT4403001:Plppr1 UTSW 4 49337648 missense probably benign 0.01
R0605:Plppr1 UTSW 4 49323466 missense probably damaging 1.00
R1381:Plppr1 UTSW 4 49337674 missense possibly damaging 0.85
R1452:Plppr1 UTSW 4 49301067 splice site probably benign
R1682:Plppr1 UTSW 4 49325617 critical splice acceptor site probably null
R1980:Plppr1 UTSW 4 49337655 missense probably benign 0.09
R4261:Plppr1 UTSW 4 49300993 missense probably benign 0.09
R4674:Plppr1 UTSW 4 49323384 missense probably damaging 1.00
R5064:Plppr1 UTSW 4 49319974 missense probably benign 0.19
R7545:Plppr1 UTSW 4 49320002 missense possibly damaging 0.88
R7823:Plppr1 UTSW 4 49325703 missense probably benign 0.01
R8049:Plppr1 UTSW 4 49300942 missense probably benign
Z1177:Plppr1 UTSW 4 49319950 missense probably damaging 1.00
Z1177:Plppr1 UTSW 4 49319995 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGCAGGCTTCATTCTCTAGAAG -3'
(R):5'- TCAGAGCAGCATGTTTGGAGG -3'

Sequencing Primer
(F):5'- TCTCGTGAAGGCTCAATGC -3'
(R):5'- GGAAAGGACCTCCGAGCTTTTTC -3'
Posted On2016-06-21